ID: 1077798947

View in Genome Browser
Species Human (GRCh38)
Location 11:5518925-5518947
Sequence CGGTTGTTATAGGTGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077798940_1077798947 6 Left 1077798940 11:5518896-5518918 CCTTCCAGGGCACACCAGCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG 0: 1
1: 0
2: 0
3: 0
4: 59
1077798942_1077798947 2 Left 1077798942 11:5518900-5518922 CCAGGGCACACCAGCATAGGAAA 0: 1
1: 0
2: 0
3: 19
4: 785
Right 1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG 0: 1
1: 0
2: 0
3: 0
4: 59
1077798937_1077798947 22 Left 1077798937 11:5518880-5518902 CCAGCAAAATCTAAGTCCTTCCA 0: 1
1: 0
2: 0
3: 12
4: 187
Right 1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG 0: 1
1: 0
2: 0
3: 0
4: 59
1077798944_1077798947 -8 Left 1077798944 11:5518910-5518932 CCAGCATAGGAAAAGCGGTTGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG 0: 1
1: 0
2: 0
3: 0
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077798947 Original CRISPR CGGTTGTTATAGGTGGCACC AGG Intronic
910242528 1:85103088-85103110 GGGAAGGTATAGGTGGCACCTGG - Intronic
916738819 1:167630605-167630627 CGGGTGTCCTAGGTGGGACCAGG - Intronic
920615721 1:207491015-207491037 CAGTTGTTGGAGGTGGGACCTGG - Intergenic
921741829 1:218694235-218694257 AGTTTGTTATAAGTGGCAACAGG + Intergenic
1072396370 10:95046938-95046960 CCATTGTTATAGGTGGAATCTGG + Intronic
1074943366 10:118256446-118256468 TGGTTGTTTTAAGTAGCACCAGG - Intergenic
1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG + Intronic
1083573194 11:63770774-63770796 AGGTTGTTGAAGGTGGCTCCAGG - Intergenic
1085427108 11:76414367-76414389 CTTTTGTTATAAGTGGTACCTGG + Intronic
1089084398 11:115804763-115804785 TGGTTGTAATATGCGGCACCAGG + Intergenic
1105260249 13:18773798-18773820 GGAATGTTAAAGGTGGCACCTGG - Intergenic
1105406078 13:20133736-20133758 TGGGTGCTAGAGGTGGCACCAGG - Intergenic
1113696459 13:112349566-112349588 CGGCTCTTAAAGGTGGCCCCGGG - Intergenic
1116713892 14:48404225-48404247 CAGTTGTTGGAGGTGGGACCTGG - Intergenic
1123474094 15:20576517-20576539 CGGTGGTTGGAGGTGGCACATGG + Intergenic
1123643916 15:22423836-22423858 CGGTGGTTGGAGGTGGCACATGG - Intergenic
1123734395 15:23171529-23171551 CGGTGGTTGGAGGTGGCACATGG + Intergenic
1124284901 15:28392837-28392859 CGGTGGTTGGAGGTGGCACATGG + Intergenic
1124297796 15:28518777-28518799 CGGTGGTTGGAGGTGGCACATGG - Intergenic
1126907481 15:53383670-53383692 CCAATGTTGTAGGTGGCACCTGG - Intergenic
1132239183 15:100244592-100244614 CGCTTCTCATGGGTGGCACCTGG + Intronic
1138998633 16:62481522-62481544 CGGTGGTTCATGGTGGCACCTGG + Intergenic
1141196107 16:81862494-81862516 AGGTTGTCAGGGGTGGCACCAGG + Intronic
1142712515 17:1731056-1731078 CGGTGGCTCTAGGTGGCCCCAGG + Exonic
1147375243 17:40019065-40019087 CTGTTGGTATTGGTGCCACCCGG - Intergenic
1148245200 17:46025734-46025756 TGGTTGTCAGTGGTGGCACCAGG + Exonic
1152286304 17:79415150-79415172 CGGTCCTCGTAGGTGGCACCGGG - Intronic
1155098705 18:22586768-22586790 CGGGTGTAATAGGTGACCCCTGG - Intergenic
1161111469 19:2473126-2473148 AGGTTGTTATGGCTGGCACGGGG + Intergenic
1163659745 19:18569532-18569554 GGGTTGTTATAGCTCCCACCAGG - Intergenic
1166708021 19:44919315-44919337 GGATTTTTATTGGTGGCACCTGG - Exonic
925868616 2:8250361-8250383 CCGTTGTTGTAGGAGGGACCTGG + Intergenic
929250368 2:39748084-39748106 CAGTTGTTAAAGCTGGCAGCAGG - Intronic
937948252 2:127361828-127361850 CGGTAGTTATAGGTGACTCTCGG + Intronic
942779542 2:179624914-179624936 TGGTTGTGATAGGTGGTATCTGG + Intronic
1171091865 20:22292968-22292990 CAGGTGTTATAGGAGGAACCTGG + Intergenic
1173257213 20:41402464-41402486 CGGAGGTTATAAGTGGAACCCGG + Exonic
1174789295 20:53462862-53462884 TGGTTATTAGAGGTGGAACCTGG - Intronic
1175470143 20:59221824-59221846 CGGTTTTGCTAGGAGGCACCTGG + Intronic
1183749486 22:39711725-39711747 CAGGTGTTATGGGTGGCATCGGG + Intergenic
1184606643 22:45578234-45578256 CGGTTGTTAAAACTGGCAGCTGG + Intronic
949521198 3:4855655-4855677 CTGTTGTTGAAGGTGGGACCTGG + Intronic
950012084 3:9731280-9731302 CGGTAGTTATGGGTAGGACCGGG - Intergenic
953983162 3:47422839-47422861 TGGTTGTTGTGGGTGGCACTTGG - Intronic
963303995 3:143629732-143629754 GGGATGTTTTAGGTGGCACTGGG + Intronic
969902492 4:10362781-10362803 CGGGTGTTGTGGGTGGTACCTGG - Intergenic
984793631 4:183637101-183637123 TGTTTGTTATTGCTGGCACCTGG - Intergenic
992028431 5:72695240-72695262 AAGTTGGTATAGGTTGCACCAGG + Intergenic
999050775 5:148521983-148522005 CACTTGTTATAGGAGGGACCTGG + Intronic
1000157451 5:158565685-158565707 CGGATGAAATAGGTGGCATCTGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1019543998 7:1564305-1564327 CGGTTTTTATAGGTGGAGACAGG + Intergenic
1020271776 7:6600875-6600897 TGGATGGTAGAGGTGGCACCAGG - Intronic
1027810795 7:82894589-82894611 CGTGTGTTGTAGGAGGCACCCGG - Intronic
1028806070 7:95027105-95027127 CTGGTGTTACAGGTGCCACCGGG + Intronic
1031245237 7:119303350-119303372 CTACTGTTAAAGGTGGCACCTGG - Intergenic
1033990001 7:147271772-147271794 CAAGTGTTATAGGAGGCACCCGG - Intronic
1041426137 8:57722713-57722735 CTGTTGCTAAAGGTGGCCCCTGG + Intergenic
1042594635 8:70433811-70433833 CGCTTCTTAAAGGGGGCACCAGG + Intergenic
1043317507 8:78939797-78939819 CAGGTGTTATAGGAGGAACCTGG + Intergenic