ID: 1077799381

View in Genome Browser
Species Human (GRCh38)
Location 11:5522963-5522985
Sequence TAGCTGTTCCAGCTGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077799379_1077799381 -7 Left 1077799379 11:5522947-5522969 CCTGAGCTGTACTTTGTAGCTGT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1077799381 11:5522963-5522985 TAGCTGTTCCAGCTGCTCCAGGG 0: 1
1: 1
2: 2
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077799381 Original CRISPR TAGCTGTTCCAGCTGCTCCA GGG Intronic
900400680 1:2471750-2471772 TGGCCGTTCCAGCTCCCCCAGGG + Intronic
900631034 1:3635419-3635441 TGGCAGTTCCAGCTTTTCCACGG - Intronic
901142201 1:7042441-7042463 GCCCTGCTCCAGCTGCTCCAGGG - Intronic
903701282 1:25250254-25250276 AAGCTGTACCAGCAGCTCCTGGG - Intronic
905881343 1:41466319-41466341 GTGCAGCTCCAGCTGCTCCATGG + Intergenic
906772080 1:48494255-48494277 TAGCTGTTCTAGCTACACAAAGG + Intergenic
907108873 1:51908530-51908552 CTGCTGTTCAACCTGCTCCAGGG + Exonic
907861656 1:58359553-58359575 GAGCTGTTCTAGCTACCCCAGGG + Intronic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
918550078 1:185732959-185732981 GAGCTATTCCAGGTGCTCAAGGG - Intergenic
919880214 1:201896037-201896059 CAGATTCTCCAGCTGCTCCAGGG - Intergenic
920379566 1:205527797-205527819 TTCATGTTCCAGCTGCTCCGGGG + Exonic
920502340 1:206493258-206493280 TAGCTCTTCCAGGAGCTGCAGGG - Exonic
922365097 1:224856008-224856030 TTGCAGTCCCATCTGCTCCAGGG - Intergenic
923083461 1:230682502-230682524 TAGCTGTCCCGTCTGCCCCATGG - Intronic
923576399 1:235162645-235162667 TTGCAGTTCCAGCTACTCCGTGG - Intronic
1065551308 10:26870928-26870950 TAGCTTTTCCATGTGCCCCATGG - Intergenic
1067419692 10:46134813-46134835 TAGCTGGACCAGCTGGGCCAGGG - Intergenic
1067426326 10:46214598-46214620 TAGCTGGACCAGCTGGGCCAGGG + Intergenic
1067505043 10:46841410-46841432 TAGCTGGACCAGCTGGGCCAGGG - Intergenic
1069799554 10:71073678-71073700 TAGCTGGTGTTGCTGCTCCATGG - Intergenic
1070665190 10:78337707-78337729 GAGCTCTTCCTGCTGCTCCAAGG + Intergenic
1071980331 10:90998830-90998852 TTCTAGTTCCAGCTGCTCCATGG + Intergenic
1072765777 10:98094101-98094123 TTGGTGTTCCAGCTACTGCAAGG + Intergenic
1073785250 10:106881983-106882005 TACCTCTTTCAGATGCTCCACGG + Intronic
1075446724 10:122518459-122518481 CACCTGTCCCAGCTGGTCCAGGG - Intergenic
1075721302 10:124589129-124589151 AACCTGTTCCTGCTGCTGCAAGG + Intronic
1076058155 10:127392292-127392314 GTGATGTCCCAGCTGCTCCAGGG + Intronic
1076773451 10:132679785-132679807 TGGCTGTCCCCTCTGCTCCATGG - Intronic
1076984445 11:224838-224860 TCCCTTTTCCATCTGCTCCAAGG - Intronic
1077799381 11:5522963-5522985 TAGCTGTTCCAGCTGCTCCAGGG + Intronic
1078264933 11:9747998-9748020 AAGCTGCTCCAGCTGCTCCATGG - Exonic
1079709706 11:23666248-23666270 TAGCTGATCCAGGTGCCCCTTGG - Intergenic
1080012471 11:27472491-27472513 TCGCCCTTCCCGCTGCTCCATGG + Exonic
1080241405 11:30131014-30131036 TGGCTGTTCCAGTTTCTTCAAGG + Intergenic
1083228146 11:61297482-61297504 CAGCTATTCCAGCTGCTCATTGG - Intergenic
1083748463 11:64747713-64747735 TAGCTGCTCTTGCTGCCCCAGGG - Intronic
1083988720 11:66233558-66233580 CAGCTGTTCCGTCTGCTTCATGG + Intronic
1084274309 11:68043867-68043889 CTGCTGTTGCAGCTGCTGCAGGG - Exonic
1088583552 11:111337577-111337599 TGGCTGTTCCAGCTGGACCCAGG - Intergenic
1088619860 11:111671027-111671049 CAGCTGCCCCAGCTCCTCCAGGG - Intronic
1089499666 11:118924941-118924963 TCGCTGCTCCAGCTGGCCCAAGG + Intronic
1092873261 12:12826008-12826030 TAGCTGTTCGACCTACTCGATGG - Exonic
1094166333 12:27447424-27447446 AGGCTGTTGCAGCTGGTCCATGG - Intergenic
1095792849 12:46186058-46186080 CATCTTTTCCAGCTGCTCTAGGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1096808496 12:54155207-54155229 TAGACCTCCCAGCTGCTCCAAGG + Intergenic
1097013406 12:55968781-55968803 TATCTGTTCCAGCTGCTCCAGGG + Exonic
1097023306 12:56035698-56035720 TAGATCTTCCAGCAGCCCCAGGG + Exonic
1097539484 12:60920488-60920510 CAGTGGTTCCAGCTTCTCCATGG + Intergenic
1098003027 12:65965477-65965499 TCTCTCTTCCAGCTGCTTCAGGG + Exonic
1098740751 12:74171011-74171033 TCCCTGCTCCAGCCGCTCCAGGG + Intergenic
1100955882 12:99907526-99907548 TTGCTGTTCCTGCTGCTTCATGG + Intronic
1100981756 12:100167568-100167590 CAGCTGTGCCCGCTCCTCCATGG + Intergenic
1102351399 12:112194916-112194938 CAGCAGTTGCAGGTGCTCCAGGG + Exonic
1105029963 12:132875074-132875096 TAGCTGTCCCGCCTGCTTCAGGG - Intronic
1107215211 13:37909202-37909224 GAGCTTTTCCAGATGCTCCTGGG + Intergenic
1108741415 13:53342812-53342834 TAGCTGGTCCAACTGCTGCAGGG - Intergenic
1109341011 13:61059034-61059056 TGGCTGCTCCTGCTGGTCCACGG + Intergenic
1112051701 13:95649489-95649511 AACCTGTGACAGCTGCTCCATGG - Intergenic
1112226159 13:97542518-97542540 ACGCTGTTGCAGCTGGTCCATGG + Intergenic
1112470956 13:99688707-99688729 TATCTCTTCCAGCTCCTGCATGG + Intronic
1113960522 13:114123287-114123309 TAGCTGCTCCAGCACCTCGAGGG + Intronic
1114476383 14:22998131-22998153 CAGCTGTCTCGGCTGCTCCATGG - Intronic
1114522510 14:23348071-23348093 TAGCTGTGCCACCTTCTCCCAGG - Intronic
1115379325 14:32717054-32717076 CACCTGATCCACCTGCTCCAGGG - Intronic
1117092977 14:52268584-52268606 GAGGTGATCCAGCTCCTCCAGGG - Exonic
1117812660 14:59565257-59565279 TAGCTCTTCCTGCTTCTCCCTGG + Exonic
1118949574 14:70422378-70422400 TTGCTGTGCCATCTGCCCCACGG + Intergenic
1120331549 14:83099756-83099778 TAGCTTTACCAGCAACTCCAAGG + Intergenic
1120435533 14:84476909-84476931 TAGCTGTTCCATCTGCAAAATGG - Intergenic
1121029891 14:90649371-90649393 TAGCTGCTGAAGTTGCTCCACGG - Intronic
1121623116 14:95363837-95363859 GAGCTGTTTCTGCTGCTCCACGG - Intergenic
1122723805 14:103737246-103737268 GAGCTGTTCCACCTTCTTCAGGG - Intronic
1123467157 15:20525978-20526000 TTGCTGTTGGAGCTCCTCCACGG + Intergenic
1123650958 15:22475064-22475086 TTGCTGTTGGAGCTCCTCCACGG - Intergenic
1123741366 15:23283906-23283928 TTGCTGTTGGAGCTCCTCCACGG - Intergenic
1123745631 15:23318652-23318674 TTGCTGTTGGAGCTCCTCCACGG + Intergenic
1124277903 15:28341969-28341991 TTGCTGTTGGAGCTCCTCCACGG + Intergenic
1124304798 15:28569639-28569661 TTGCTGTTGGAGCTCCTCCACGG - Intergenic
1124643800 15:31420325-31420347 ACACTGTGCCAGCTGCTCCATGG - Intronic
1124932507 15:34135567-34135589 TGGATGTGCCAGCTGCTACAAGG + Intergenic
1125832435 15:42726346-42726368 GAGCTGTTCCAGATGCTCTGGGG + Exonic
1125972259 15:43921511-43921533 GAGCTGTCACAGCTGATCCATGG + Intronic
1126002008 15:44219567-44219589 TAGCTGTTGCAGTTCCTCCATGG + Intergenic
1126994224 15:54421469-54421491 TAGCTGATGCTGCTGGTCCAGGG - Intronic
1127774677 15:62255551-62255573 CAGCTGTGCCCGCTCCTCCATGG + Intergenic
1131282935 15:91035205-91035227 CAGCTGTGCCCGCTCCTCCATGG + Intergenic
1131387114 15:92017157-92017179 TAGCAGCTTCAGCTGCTGCAGGG + Intronic
1133256801 16:4522159-4522181 CAGCTGGGCCACCTGCTCCACGG + Intronic
1133934985 16:10261662-10261684 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1134540009 16:15056306-15056328 TGGCTGGTGCAGCTGCTCCCTGG - Intronic
1135380384 16:21991356-21991378 TTGCAGTCCCAGCTCCTCCAGGG - Intronic
1136450276 16:30350898-30350920 TGCCTTTTCCAGCTCCTCCAGGG + Exonic
1138922796 16:61553506-61553528 CAGATGTTCCAGTTGCTCCTGGG + Intergenic
1139418131 16:66830879-66830901 CAGCTTTCCCAGCTGCGCCATGG + Exonic
1139475731 16:67201737-67201759 CAGCTGCTCCCGCTGCTCCTGGG - Exonic
1140171203 16:72606840-72606862 TAGATAACCCAGCTGCTCCAGGG - Intergenic
1142179304 16:88659597-88659619 TGGCAGTTCCAGCTTCTGCAGGG - Intronic
1143024171 17:3931248-3931270 TACCTGTTACAGCTGCACCTTGG - Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1144781766 17:17811867-17811889 TACCTGTTCCCCCTGCTCCCAGG - Intronic
1146640519 17:34537245-34537267 TAGCAGTTCCTTGTGCTCCAGGG + Intergenic
1146707995 17:35015925-35015947 TAGCTGTTCCATCTGCACTTGGG - Intronic
1148412697 17:47481572-47481594 TAGAGGTTCCAGCTACTCAAGGG + Intergenic
1150652726 17:67020301-67020323 GAGCTGTTCCAGCTCCTCTGGGG + Intronic
1151464786 17:74277557-74277579 CTGCTGCCCCAGCTGCTCCAGGG + Intronic
1151744099 17:76002251-76002273 TACCTCTTCCAGCTGCTGCAGGG + Exonic
1152241016 17:79161191-79161213 TAGCTGGGCCACCTCCTCCAGGG - Intronic
1152777454 17:82211829-82211851 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1152913630 17:83020432-83020454 TAGCTTTTCCAGCTATTCTATGG - Intronic
1153961938 18:10147511-10147533 GAGCAGCTCCAGCTCCTCCATGG + Intergenic
1158411278 18:57208281-57208303 GAACTCTTCCAGCTGATCCAGGG + Intergenic
1159137718 18:64356441-64356463 TAGAAAGTCCAGCTGCTCCAAGG - Intergenic
1159748125 18:72264603-72264625 TAGCTGGCTCAGCTGCCCCAAGG - Intergenic
1160235472 18:77082679-77082701 CACCTGGTCCAGCTGCTGCAGGG - Intronic
1160551251 18:79694959-79694981 TAGTTTTTTCAGCTGTTCCACGG + Intronic
1161120028 19:2520638-2520660 TAGCTGTTCCACCAGCTTCCGGG + Exonic
1161581243 19:5082219-5082241 AAGGTGATCCAGCGGCTCCAGGG - Intronic
1163029940 19:14537365-14537387 TAGCTGTTTCAGCCGCACCCAGG + Intronic
1163725846 19:18922612-18922634 GCGCTGGTCCAGCTGCTCCACGG - Exonic
1164156247 19:22599282-22599304 CAGCTGTGCCCGCTCCTCCATGG - Intergenic
1164310872 19:24045176-24045198 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1165006710 19:32813286-32813308 AAGTTGTTCCTCCTGCTCCAAGG - Intronic
928103769 2:28454317-28454339 TAGCTCTTCTGTCTGCTCCACGG + Intergenic
928285405 2:29985993-29986015 TAGCTGTTGAAGCTGCCACAAGG - Intergenic
932749353 2:74361520-74361542 AAGCTGGTGCAGCTGCTCCTGGG + Exonic
933739003 2:85518245-85518267 CTGTAGTTCCAGCTGCTCCAGGG - Intergenic
933783597 2:85819844-85819866 TGCCTGTTCCAGTTGCTGCATGG + Intergenic
937146227 2:119647266-119647288 TAGCTCTTCCAGGAGCTCAAGGG + Intronic
937284215 2:120739655-120739677 CAGCTGTTCCCGCTGGGCCAGGG + Intronic
938892803 2:135722534-135722556 TACCTGTTTCTCCTGCTCCAAGG - Exonic
939548275 2:143581304-143581326 TTGCTGTGCCAGCTGGTACATGG + Intronic
940276938 2:151949462-151949484 TAACTGTTCCATCTCCTTCAAGG - Intronic
941542248 2:166801389-166801411 TAGCTGGTCCTGCAGCTCAAAGG + Intergenic
942543412 2:177038063-177038085 AAGCCTTTCCTGCTGCTCCATGG - Intergenic
943479928 2:188405026-188405048 GGACTGTTCCAGCTGATCCAGGG + Intronic
944746930 2:202666789-202666811 TAGCTGTCCCAGCTACTCAGCGG - Intronic
946829792 2:223716960-223716982 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
946947669 2:224838395-224838417 TAACACTACCAGCTGCTCCATGG + Intronic
947324011 2:228955163-228955185 TATCTGTTCCATGTGGTCCACGG - Intronic
947785593 2:232815694-232815716 TAGCTGCTGAAGCTGTTCCAGGG - Exonic
1173788844 20:45814452-45814474 TTACTGTTCCAGCTGCTCCATGG - Exonic
1174525375 20:51166251-51166273 TTGCTGTCCCTACTGCTCCAAGG + Intergenic
1175856661 20:62124127-62124149 TTTCTGTTACAGCTGTTCCAAGG + Intronic
1177718420 21:24871263-24871285 TCTCTGTTGCAGCTGCTCAACGG - Intergenic
1179616580 21:42587088-42587110 TAACTTTCCCAGCAGCTCCAAGG - Intergenic
1181871645 22:25903812-25903834 TACCTGCTCCAGCTGCTTGATGG - Exonic
1183706249 22:39476446-39476468 AAGCTGTCTCACCTGCTCCATGG + Intronic
1184232416 22:43165686-43165708 GGGCTGTCCCAGCTGCTCCCTGG + Intergenic
1184582338 22:45426117-45426139 GATCTGCTCCAGCTGCTCCTGGG - Exonic
949558548 3:5181662-5181684 TGGTAATTCCAGCTGCTCCAAGG + Intergenic
950721880 3:14889058-14889080 TAGCTGCACCAGCTCCTGCAGGG + Intronic
951867222 3:27321748-27321770 GAGCTTTACTAGCTGCTCCAGGG - Intronic
953418369 3:42735896-42735918 TAGCTGCTTCAGCTGGTCCTGGG + Exonic
953519857 3:43631531-43631553 TAGGTGTTCCAGCTACTAAAAGG + Intronic
955110806 3:55947697-55947719 TAACTGGCCCAGCTGCTCTAGGG - Intronic
956414714 3:69013707-69013729 AAGGTGTCCCAGCTGCTCCTTGG - Exonic
957840042 3:85655871-85655893 ATGCTGTTGCAGCTGGTCCAAGG + Intronic
961468596 3:127097144-127097166 GGGCTGGTCCTGCTGCTCCAGGG - Intergenic
962735457 3:138321598-138321620 ATGCTCTTTCAGCTGCTCCAGGG + Intronic
962892423 3:139683943-139683965 GAGCTGGTACAGCAGCTCCACGG - Intergenic
967621658 3:191641893-191641915 TAGCTGTTGTAGCTTCACCAAGG + Intergenic
969466616 4:7361014-7361036 TAGCTGTCACAGAAGCTCCAGGG - Intronic
969533863 4:7744061-7744083 TAGCTGGGCCAGGTGCTCCCTGG - Intergenic
972458109 4:39273671-39273693 TAGCTGTTCAAGCCTTTCCAAGG + Intronic
974065409 4:57072790-57072812 ATGCTGTGCCAGCTGCTCAATGG - Intronic
975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG + Intergenic
978443603 4:108759853-108759875 TAGCAGTTCCATCTGTTTCAGGG + Exonic
983499591 4:168483796-168483818 TACCTTTTCCAGCTTCTACAGGG - Intronic
983917412 4:173307634-173307656 TCTCTGTTGCAGCTGATCCAGGG + Intronic
987145187 5:14984857-14984879 TAGATGTTCTAGCAGCTCCAGGG + Intergenic
988489931 5:31697702-31697724 AAGCCCCTCCAGCTGCTCCATGG + Intronic
988799920 5:34686980-34687002 TGGCTGTTCCTTCTTCTCCATGG + Intronic
988807065 5:34750398-34750420 TAACTGTACCAGATTCTCCAGGG + Intronic
989352671 5:40504424-40504446 TAGCTCTTACAGTTGCTCTAGGG - Intergenic
989512354 5:42302909-42302931 TAGCTAATCCAGCTGTTCTATGG - Intergenic
992003493 5:72456847-72456869 TTGTTGTTCCAGCTGCTGCTGGG + Intronic
992085586 5:73275346-73275368 CAGCTGTTCCATTTTCTCCAAGG - Intergenic
995060333 5:107806331-107806353 TTGCAGCTCCAGCTGCACCAGGG + Intergenic
997078571 5:130710840-130710862 TAGCTGCTCCTGCTGCTACTTGG - Intergenic
997202825 5:132023048-132023070 TGTCTGTCCCAGCTGCTCAAGGG - Intergenic
1000005158 5:157176356-157176378 TAGCTGTTCCAGCTCCTGTCGGG - Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1004248775 6:14005089-14005111 TAGAAGTTCCTGCTCCTCCAAGG + Intergenic
1009973008 6:70644774-70644796 TAACTATTCCCCCTGCTCCAGGG - Intergenic
1015054213 6:128880255-128880277 TAGGAGTTCCAGATGCTCTATGG - Intergenic
1016595717 6:145797592-145797614 TTGATGTTCCTGCTGGTCCAAGG + Exonic
1017211037 6:151856780-151856802 TTGCTCTTCCAGCTCCTCCCCGG - Intronic
1017763094 6:157586061-157586083 CAGATCTTCCTGCTGCTCCAGGG - Intronic
1018264553 6:162008578-162008600 TAGCTTTTCCAGATTCTCCTGGG - Intronic
1019451837 7:1102917-1102939 TTTCTGTTCAAGCTGCTGCAGGG - Intronic
1019573215 7:1723625-1723647 CAGCTCTCCCAGCTTCTCCAGGG + Intronic
1020715792 7:11673768-11673790 GAGCTATTCCAGATGTTCCAAGG - Intronic
1022234266 7:28446029-28446051 AAGGTGCTCCAGCTGGTCCAAGG - Intronic
1022358288 7:29636694-29636716 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1022359694 7:29646203-29646225 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1023002499 7:35825074-35825096 GAGCTGCTCCAGCTGCTCAGGGG - Intronic
1024434841 7:49339697-49339719 TTGCTCTTCCAGTTGCTCCAGGG - Intergenic
1024818422 7:53298029-53298051 TTGCTGCTCCCGCTGCCCCACGG + Intergenic
1026841241 7:73671009-73671031 CAGCTGCTCCATCTGCTCCTGGG - Exonic
1028784734 7:94779513-94779535 CAGCTGTTCTAGCTTTTCCAGGG + Intergenic
1031610847 7:123825353-123825375 TGGCTATTTCAGCTGCTCTAAGG - Intergenic
1031932114 7:127695890-127695912 TAGCTGGGCCAGATGCTTCATGG + Intronic
1032069442 7:128794747-128794769 AAGCAGATCCAGCAGCTCCAAGG + Exonic
1032490912 7:132323559-132323581 TAGATCTTCCTCCTGCTCCACGG + Intronic
1032720662 7:134548703-134548725 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
1032721988 7:134557548-134557570 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1034830772 7:154305532-154305554 TACCTGTTCCTGCTGCTGCACGG - Exonic
1035015551 7:155762749-155762771 TAGCTGTGCCAGTGTCTCCAGGG - Intronic
1035166426 7:156993128-156993150 CAGCTGCTCCAGCTGCCCCTAGG - Intergenic
1036646955 8:10616926-10616948 GTGCTGCTCCAGCTGCTTCAGGG - Intronic
1036647772 8:10622905-10622927 TCCATCTTCCAGCTGCTCCAGGG + Exonic
1038727459 8:30094612-30094634 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1040101914 8:43513227-43513249 TGGCTGGTCCACCTGCTCCTGGG - Intergenic
1040565669 8:48564685-48564707 GAGCTGTTCCAGTAGCACCAGGG - Intergenic
1041569023 8:59314793-59314815 TACCTGTTCCACCTGTTCAAAGG - Intergenic
1042426513 8:68655273-68655295 TAGCTGTACCAGCTACTAAAAGG + Intronic
1043547912 8:81335927-81335949 TAACTATTCCAGCTGCTACACGG - Intergenic
1043982690 8:86659306-86659328 CAGCTGTGCCTGCTCCTCCATGG + Intronic
1044986691 8:97762183-97762205 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
1049344681 8:142132456-142132478 TCGCTGTCCCAGCTGCTCCGTGG - Intergenic
1049800443 8:144515196-144515218 TTGGTGCCCCAGCTGCTCCAGGG + Exonic
1053372216 9:37571994-37572016 TGGCTGTCCCAGCTGCTCAGGGG + Intronic
1053478307 9:38397604-38397626 TAGCTCTTCCTGCTGATCCAAGG + Exonic
1053512723 9:38702554-38702576 GAGCTGATCCTTCTGCTCCAAGG + Intergenic
1053750222 9:41246195-41246217 AAGCTGCACCAGCTGCTCCTGGG + Intergenic
1054255720 9:62810533-62810555 AAGCTGCACCAGCTGCTCCTGGG + Intergenic
1054335591 9:63805075-63805097 AAGCTGCACCAGCTGCTCCTGGG - Intergenic
1057224280 9:93280380-93280402 TAAGAGTTCCAGCTCCTCCATGG - Intronic
1058975399 9:110121438-110121460 CAGCTTTTCAAGCTGCTCCAAGG - Intronic
1060795090 9:126507797-126507819 CAGCTGTTCTATCTGCACCACGG - Intergenic
1061054235 9:128213929-128213951 TCTCTGTTCCTGCTGCCCCAGGG - Intronic
1061063308 9:128261686-128261708 CAGCTGTGCCCGCTCCTCCATGG + Exonic
1062123765 9:134848543-134848565 AAGCTTTTGCAACTGCTCCAGGG + Intergenic
1185750297 X:2605541-2605563 CAGCACTTCCAGCTGCTCCGTGG + Intergenic
1188736119 X:33718422-33718444 TAGCTGATCCTGCTGGTCTAAGG - Intergenic
1190063680 X:47226282-47226304 TTCCTGTTCCAGCTGCTCCGTGG + Exonic
1190161047 X:48031536-48031558 TCACGGTTCCAGCTGCTGCAGGG - Intronic
1190876746 X:54465477-54465499 TATCTGTTAAAGCTGCCCCATGG - Exonic
1194722936 X:97361808-97361830 AAGCTTTTCCAGCAGCTCCTGGG + Intronic
1195640837 X:107173025-107173047 GAGCTGCTCCACCTGCTCCAGGG + Intronic
1197674978 X:129319593-129319615 TGCCTGTGCCAGCTGCTACAGGG + Intergenic
1199246380 X:145609864-145609886 TGACTGTTGCAGCTGCTCTATGG - Intergenic