ID: 1077799590

View in Genome Browser
Species Human (GRCh38)
Location 11:5524770-5524792
Sequence CACTCTCTCCCAAAACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077799583_1077799590 15 Left 1077799583 11:5524732-5524754 CCATCTTTCTTTTCTTCCTCCCT 0: 5
1: 53
2: 1036
3: 8528
4: 53794
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799585_1077799590 -4 Left 1077799585 11:5524751-5524773 CCCTGTTTCTGTCTACCCTCACT 0: 1
1: 1
2: 3
3: 26
4: 364
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799584_1077799590 -1 Left 1077799584 11:5524748-5524770 CCTCCCTGTTTCTGTCTACCCTC 0: 1
1: 1
2: 5
3: 73
4: 729
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799582_1077799590 16 Left 1077799582 11:5524731-5524753 CCCATCTTTCTTTTCTTCCTCCC 0: 1
1: 3
2: 48
3: 634
4: 4133
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799586_1077799590 -5 Left 1077799586 11:5524752-5524774 CCTGTTTCTGTCTACCCTCACTC 0: 1
1: 1
2: 0
3: 23
4: 280
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077799590 Original CRISPR CACTCTCTCCCAAAACCTGG AGG Intronic