ID: 1077799590

View in Genome Browser
Species Human (GRCh38)
Location 11:5524770-5524792
Sequence CACTCTCTCCCAAAACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077799586_1077799590 -5 Left 1077799586 11:5524752-5524774 CCTGTTTCTGTCTACCCTCACTC 0: 1
1: 1
2: 0
3: 23
4: 280
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799583_1077799590 15 Left 1077799583 11:5524732-5524754 CCATCTTTCTTTTCTTCCTCCCT 0: 5
1: 53
2: 1036
3: 8528
4: 53794
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799582_1077799590 16 Left 1077799582 11:5524731-5524753 CCCATCTTTCTTTTCTTCCTCCC 0: 1
1: 3
2: 48
3: 634
4: 4133
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799584_1077799590 -1 Left 1077799584 11:5524748-5524770 CCTCCCTGTTTCTGTCTACCCTC 0: 1
1: 1
2: 5
3: 73
4: 729
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1077799585_1077799590 -4 Left 1077799585 11:5524751-5524773 CCCTGTTTCTGTCTACCCTCACT 0: 1
1: 1
2: 3
3: 26
4: 364
Right 1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077799590 Original CRISPR CACTCTCTCCCAAAACCTGG AGG Intronic
901034898 1:6330608-6330630 CCCTCCCTCCCACATCCTGGAGG - Intronic
902803505 1:18846256-18846278 CACTAGCTCCCATCACCTGGTGG - Intronic
904448901 1:30598502-30598524 CATTCTCACCAAAACCCTGGGGG - Intergenic
904813403 1:33178859-33178881 TACTCTATCCCATGACCTGGGGG - Intronic
904844229 1:33396696-33396718 CACTCTCTCCCCATACCAGAGGG - Intronic
905526057 1:38640767-38640789 CACTCTACCTCAAAACCTCGTGG - Intergenic
906184740 1:43853167-43853189 CACTTTCTCCCAATACCGAGTGG - Intronic
906276899 1:44523418-44523440 CACTGTCTCCCCACAGCTGGAGG - Intronic
906961622 1:50422656-50422678 GACTCTGTCCCTAAACCCGGAGG - Intronic
907264815 1:53251334-53251356 GATTCTCTCCCAAAACTGGGGGG + Intronic
908034954 1:60041922-60041944 CACTATGCCCCAAAGCCTGGGGG + Intronic
908117005 1:60950362-60950384 CACTCATTCCCAAAACCTCTTGG + Intronic
909387921 1:75081516-75081538 TACTTTCTCACAGAACCTGGAGG - Intergenic
913501854 1:119479027-119479049 CACTCTCTCCCCAAAGGTAGGGG + Intergenic
916042025 1:160969622-160969644 CAATCTCCCCCAAAATTTGGAGG - Intergenic
920791583 1:209097856-209097878 CACTCTCTTCCAAACACTGGAGG + Intergenic
923326557 1:232885398-232885420 CACTCTTTCCTAAAAGTTGGGGG - Intergenic
1065872357 10:29966446-29966468 CACTCTCTCCCTCCACCTGCTGG + Intergenic
1066318875 10:34279177-34279199 CACTCTGTCACAAAAGCTGGAGG + Intronic
1068776428 10:60872916-60872938 CATTCCCTCCCCAGACCTGGTGG + Intronic
1069291298 10:66783783-66783805 CTCTATCTCCAAAAACATGGTGG - Intronic
1070009678 10:72460127-72460149 CACTTTATCCTAAAACCTGTAGG - Intronic
1070148853 10:73793232-73793254 CAATCTGTCCAAAATCCTGGAGG - Intronic
1072764083 10:98081980-98082002 CCCTCTCTCTGAAAAGCTGGTGG - Intergenic
1072944425 10:99796997-99797019 CCCTCTATCCCAGAACCTGGAGG + Intronic
1075002447 10:118808627-118808649 CACTCTGTTTCACAACCTGGTGG + Intergenic
1075561251 10:123470146-123470168 CACCCAAACCCAAAACCTGGGGG - Intergenic
1076890775 10:133282192-133282214 CTCTCTCTGGCCAAACCTGGAGG + Intronic
1077799590 11:5524770-5524792 CACTCTCTCCCAAAACCTGGAGG + Intronic
1077855802 11:6123236-6123258 CAACCTCTACCAGAACCTGGAGG + Intergenic
1077960478 11:7072089-7072111 CAAACTATCCCAAAACTTGGTGG + Intergenic
1080822646 11:35821885-35821907 CACTCTGTCCCCAAGGCTGGAGG - Intergenic
1081616148 11:44592503-44592525 GATTCTCTCCCAAAGCCAGGCGG - Intronic
1083488833 11:63000149-63000171 CGCTGTGTCCCAAAACCTGGAGG + Intronic
1084534984 11:69751261-69751283 CACTCTCTCCCCAGTCCTGGTGG - Intergenic
1085991886 11:81858062-81858084 CCCTCTCTCTCACAACCTGCTGG - Intergenic
1087141860 11:94771820-94771842 TACTCTCTCCTAAAAGATGGGGG - Intronic
1088543340 11:110936082-110936104 CAGGCTTTCCCAATACCTGGAGG + Intergenic
1088983675 11:114887245-114887267 CACTGTCTCCCACAGGCTGGAGG + Intergenic
1089175726 11:116547648-116547670 CCCTCTCTCCCAAAGCCCAGAGG + Intergenic
1089681563 11:120121724-120121746 CACCCCCTCCCACAACCTGCAGG + Intronic
1090082528 11:123623559-123623581 CTCCCTCTCTCAAATCCTGGAGG - Intronic
1090911367 11:131122543-131122565 CACTCTCTCGGAAGGCCTGGAGG - Intergenic
1094349628 12:29509466-29509488 CGCTCCTTCCCCAAACCTGGGGG - Intronic
1096796489 12:54081280-54081302 CCTTCTCTCCCACAACCTGGAGG + Intergenic
1096857237 12:54492826-54492848 CAGTTTCTCCCATAAACTGGAGG - Intergenic
1097269498 12:57765499-57765521 CACTCTCTCCTCAACCCTGCAGG - Exonic
1097773251 12:63614964-63614986 TACTCCTGCCCAAAACCTGGAGG - Intronic
1098213015 12:68186184-68186206 CACCCTCTCCAAGACCCTGGGGG + Intergenic
1100855595 12:98754755-98754777 CATTCTCTCCCAAAACCTTTAGG - Intronic
1102761893 12:115394832-115394854 CTCTTTCTCCCAAAACCAAGAGG + Intergenic
1103558425 12:121779591-121779613 CACATTCTCCCGAAACTTGGCGG + Exonic
1104243987 12:127019256-127019278 CACTCTCACCCAGTAACTGGGGG - Intergenic
1104941103 12:132395742-132395764 CACGCTCCCCCAAAACGTGCAGG + Intergenic
1106011255 13:25825714-25825736 CACTCTCTCCCTACCACTGGAGG - Intronic
1106247818 13:27963874-27963896 CAGTCTCTCACAAAAACTAGAGG - Intronic
1108493748 13:51005128-51005150 CACCCTCCCCCAGAGCCTGGTGG + Intergenic
1111538319 13:89633637-89633659 CAAACTCTCCCAAAACTTAGGGG - Intergenic
1112420035 13:99240142-99240164 CATTCACTGCCAAAATCTGGAGG - Intronic
1113064421 13:106358991-106359013 CTCTCTCTCCCTGTACCTGGTGG + Intergenic
1113352581 13:109543907-109543929 CACTATCTTCCAAAATCTGCAGG - Intergenic
1114537887 14:23434343-23434365 CACCCTCTTCCAAAACAAGGTGG + Intronic
1115912553 14:38272479-38272501 CACACACTCACAAAACCAGGTGG - Intergenic
1121511143 14:94514422-94514444 CACTCTCTGCCAGCCCCTGGTGG + Intronic
1122475121 14:102002530-102002552 CATCCTCTTCAAAAACCTGGTGG - Exonic
1124954645 15:34352238-34352260 TACTCCCTCCCAAAACCTTTTGG + Intronic
1125641175 15:41231566-41231588 CTCTCGGTCCCCAAACCTGGAGG - Intronic
1126730974 15:51681807-51681829 CAAGCTTTCCCCAAACCTGGAGG + Exonic
1130307835 15:82726693-82726715 CAAGCTCTCCCACAGCCTGGTGG - Intergenic
1130972596 15:88745326-88745348 CACTCTCTCCAGAAATGTGGAGG - Intergenic
1132690175 16:1178597-1178619 CTCACTCTCCCACAGCCTGGAGG - Intronic
1135313346 16:21422362-21422384 AACACTCTCCCAAAACATCGTGG - Intronic
1135356258 16:21771721-21771743 CAGTCTCCCCAAAAACTTGGAGG + Intergenic
1135366270 16:21854640-21854662 AACACTCTCCCAAAACATCGTGG - Intronic
1135445545 16:22516524-22516546 AACACTCTCCCAAAACATCGTGG + Intronic
1135454749 16:22587860-22587882 CAGTCTCCCCAAAAACTTGGAGG + Intergenic
1136310015 16:29401077-29401099 AACACTCTCCCAAAACATCGTGG - Intronic
1136323457 16:29502867-29502889 AACACTCTCCCAAAACATCGTGG - Intronic
1136438142 16:30242836-30242858 AACACTCTCCCAAAACATCGTGG - Intronic
1136596283 16:31252367-31252389 CCCCCTATCCCAAAACCTGTAGG - Intergenic
1137949716 16:52772042-52772064 CACTCTGTCTCAAACCCTGGTGG - Intergenic
1138237458 16:55396889-55396911 CACTCTGTCCCAAAACATACCGG + Intronic
1139857701 16:69993467-69993489 AACACTCTCCCAAAACATCGTGG - Intergenic
1143313420 17:6012873-6012895 CACTCTCTCCCCATACCAAGGGG + Intronic
1147301706 17:39534322-39534344 CATTCTCTCTCAAAACCTGCTGG - Exonic
1147581647 17:41630621-41630643 CCGTCTCTCCCAGATCCTGGTGG - Intergenic
1148450886 17:47777278-47777300 AACTCTCTCCCAAAAACCAGAGG - Intergenic
1149754576 17:59176388-59176410 GAGTCTCTCCCCAAGCCTGGGGG - Intronic
1150622502 17:66818671-66818693 CTCTATGTCCCACAACCTGGAGG - Intergenic
1151319901 17:73346785-73346807 CCCACTCTCCAAAGACCTGGGGG + Intronic
1152244011 17:79175917-79175939 CACTCTCTCTGACCACCTGGGGG + Intronic
1154119141 18:11636720-11636742 AACACTCTCCCAAAACATCGTGG - Intergenic
1155167090 18:23240250-23240272 CTCTCCCTACCAAAACCTGGTGG - Intronic
1155174602 18:23291381-23291403 CACGCTGTCCCAAAACTTAGTGG + Intronic
1155339812 18:24802651-24802673 CACCCTTTCCCAAGACCTGGAGG + Intergenic
1155693551 18:28655961-28655983 TACTCTCTCCAAATACCTAGAGG + Intergenic
1156508046 18:37611196-37611218 CACTCTCTCCCCAACCATGGTGG - Intergenic
1156730267 18:40185512-40185534 AACTCTGACCCAAAACCTGCAGG - Intergenic
1158419534 18:57280447-57280469 CATGCTGTCCCAAAACCTGGTGG + Intergenic
1160184720 18:76667049-76667071 GTCTCTCTCTCAACACCTGGGGG + Intergenic
1162226928 19:9230513-9230535 CACTCTCTGCCATAAACTGTAGG + Intergenic
1163942173 19:20505549-20505571 CACTCTCTAAAAAAAACTGGAGG - Intergenic
1164188440 19:22893921-22893943 CACTCTCCCCAAACACCTGCCGG - Intergenic
1166409787 19:42548841-42548863 CTCTCTCTCTCAGGACCTGGAGG + Intronic
1167623115 19:50569518-50569540 CACCCGCTGCCAACACCTGGGGG - Intergenic
925449169 2:3953558-3953580 CACTCTGTGCTAAGACCTGGGGG + Intergenic
925494260 2:4428275-4428297 CACCCTATCCCAAAACTTAGTGG + Intergenic
925519348 2:4724797-4724819 CACTCTGTCACCAAGCCTGGAGG + Intergenic
925661763 2:6210127-6210149 CACTCTCTCCCTCAAGCTGTGGG - Intergenic
926720945 2:15959710-15959732 CAATTTCTCCCAAAACCACGAGG - Intergenic
927381354 2:22482645-22482667 CACTGTCTCCTAAAATGTGGCGG + Intergenic
930981769 2:57534404-57534426 CAGTCTCTCACAAAATTTGGAGG - Intergenic
931115741 2:59164727-59164749 CCCACCCTCCCAGAACCTGGAGG - Intergenic
932419880 2:71595471-71595493 CACTCTGTCCCCGACCCTGGTGG + Intronic
936065825 2:109331458-109331480 CACTTTCTCCCAAAACCTCAGGG + Intronic
936940984 2:117883698-117883720 GACTCTCTCCCACAACATGTGGG - Intergenic
937811891 2:126208557-126208579 CTCTGTCTCCCAATACCTGAAGG - Intergenic
944997853 2:205314703-205314725 GACTGTCTCCAAAATCCTGGTGG - Intronic
945684920 2:212957658-212957680 CAAAGTCTCCCAAAACTTGGTGG - Intergenic
947161261 2:227217265-227217287 GACTCTCTCCCACAACATGTGGG + Intronic
948797519 2:240412461-240412483 CAATCACACCCAAAGCCTGGGGG - Intergenic
1169067915 20:2704969-2704991 TTGTCTCTCCCAAAGCCTGGAGG + Intronic
1171487074 20:25493052-25493074 CACTCTGTCCTGGAACCTGGTGG - Intronic
1173142382 20:40495421-40495443 CACCCCCTCCAAAAACTTGGAGG - Intergenic
1173387471 20:42602292-42602314 CAGTCTCTCCCAAGACTTGCAGG - Intronic
1173407591 20:42779994-42780016 CACTCTCTGCAAATTCCTGGAGG + Intronic
1174396738 20:50251269-50251291 CTCTCTGTCCCAACGCCTGGTGG - Intergenic
1174536023 20:51251995-51252017 CTCTCTCAACCAAGACCTGGTGG - Intergenic
1175235990 20:57512044-57512066 CACTGTCTTCCAAAGCTTGGAGG - Intronic
1175292035 20:57882423-57882445 AACACTCCCGCAAAACCTGGGGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1177549552 21:22601946-22601968 CCCTATCTGCAAAAACCTGGTGG + Intergenic
1181695822 22:24592408-24592430 CACTGTCTCCCGGATCCTGGAGG + Intronic
1182876962 22:33700650-33700672 CCCTCTCCCCCAAATGCTGGTGG + Intronic
1183067061 22:35370567-35370589 AACTCTCTTCCAAATCCTGTTGG + Intergenic
1185330934 22:50251734-50251756 CACTCCCTCCTTAAACCTCGGGG - Intronic
949414005 3:3797805-3797827 AAGTCTCTTCCAAAACCTGGAGG + Intronic
950637105 3:14323156-14323178 TACTCTACCCCATAACCTGGGGG - Intergenic
950899368 3:16483354-16483376 CCCTCCCTCCCAGAACCTGCAGG + Intronic
952176825 3:30872938-30872960 CACTGTTTTCCAAAACTTGGAGG + Intronic
952728905 3:36618776-36618798 CACTCCTTCCCAAAGCCTTGAGG - Intergenic
954025695 3:47781660-47781682 CGGGCTCTCCCAAAACTTGGTGG + Exonic
961370059 3:126423464-126423486 CAGTCCCTGCCAAAACCTGTGGG + Intronic
965287572 3:166837084-166837106 AACTCTGTGCCAAAAACTGGGGG - Intergenic
965504573 3:169498605-169498627 CACACTATCACAAGACCTGGTGG + Intronic
965685610 3:171299098-171299120 CAGTCTCCCACAAAATCTGGAGG - Intronic
965777198 3:172243604-172243626 CACTCCCTCCCACAACATGTGGG + Intronic
966427206 3:179792313-179792335 AACTCTCTCCCAAAATCAGTTGG - Intergenic
967308666 3:188085194-188085216 CACTCCCTCCCACCACGTGGAGG - Intergenic
967997450 3:195177492-195177514 CAGTCTCTGACACAACCTGGTGG + Intronic
968065994 3:195759928-195759950 CACACACGCACAAAACCTGGAGG + Intronic
968287122 3:197515310-197515332 CACTCTCCACCAAAGCCTTGCGG + Intronic
969664509 4:8549427-8549449 CACTCTTTCCTGGAACCTGGAGG + Intergenic
970489350 4:16556418-16556440 CACTATATTCCAAAGCCTGGGGG - Intronic
971488003 4:27181060-27181082 CACTCTATCCCCCAAGCTGGAGG + Intergenic
972040422 4:34588894-34588916 TTCTCTCTGCCATAACCTGGTGG - Intergenic
972249151 4:37281002-37281024 TACTCTCTCCCACAGCCAGGAGG - Intronic
973255820 4:48112171-48112193 CATTCTCTCACACATCCTGGGGG + Intronic
975711965 4:77169855-77169877 AACCCTCCCCCAAAACCTCGTGG - Exonic
976454246 4:85228058-85228080 CAGTCTCTCCCACAACATGTGGG + Intergenic
976700025 4:87959783-87959805 CAGTCTCTCCTAAAACAGGGTGG + Intergenic
976830118 4:89306433-89306455 CCCTCTCTCCCAAATCTTGCTGG + Intronic
978333172 4:107637470-107637492 CATTCTCTCCCCACACCTGACGG + Intronic
979318722 4:119298971-119298993 CAGTCTCTACCAAAACAGGGAGG + Intronic
982624095 4:157743535-157743557 GATTCCCTCCCAATACCTGGAGG - Intergenic
985103761 4:186482593-186482615 CCCTCTCTCCCAGCTCCTGGAGG + Intronic
985214026 4:187629815-187629837 CAAACTCTCCCAAAAACTTGAGG + Intergenic
985247926 4:187995658-187995680 CACGCCCTCCCTAACCCTGGCGG + Intergenic
985999308 5:3617758-3617780 CCCTCTCTCCCAGCCCCTGGGGG - Intergenic
987204180 5:15608272-15608294 CAGCCTCTCCCAAACCCTGCAGG + Intronic
988990806 5:36668933-36668955 CACTCTCTCCGAATAGCTGTAGG + Intronic
989195123 5:38708923-38708945 CACCCTCTCCTAGAAGCTGGGGG + Intergenic
990557963 5:56953465-56953487 CACTCTCTCCAAATTCCTGTAGG - Intronic
993133513 5:83928311-83928333 AATTCTCTCCCACAAACTGGGGG - Intergenic
995271349 5:110223014-110223036 CACTCTCTTCCAATAACAGGTGG - Intergenic
996454409 5:123663438-123663460 AGCTCTCACCCAAAACCTGTTGG + Intergenic
996675325 5:126168277-126168299 CATTCACTCACAATACCTGGGGG + Intergenic
999394353 5:151217608-151217630 CCCTCTCTCCCAGATCCTGGTGG + Intronic
1001334164 5:170783893-170783915 CCCTCTCTCCAGACACCTGGAGG - Intronic
1002143773 5:177162263-177162285 CACTCTCTTGCCCAACCTGGAGG - Intronic
1002567109 5:180118439-180118461 CACCACCTCCCAAAACCTGAGGG - Intronic
1006004146 6:30989051-30989073 CTCTGTCTTCCAAGACCTGGAGG - Exonic
1006116843 6:31780146-31780168 CCCTCTCTCCCCAAGCCCGGAGG - Exonic
1011491978 6:87901638-87901660 CAGTCTCCCCTAAAACTTGGGGG + Intergenic
1012324057 6:97892085-97892107 CACTCTCTCCCAAAAAAGGCTGG + Intergenic
1017021952 6:150147142-150147164 TAATCTCTTCCAAACCCTGGTGG + Intronic
1017665819 6:156719596-156719618 CACTCTGTCTCAAAGGCTGGAGG + Intergenic
1019094056 6:169564578-169564600 CACACTCTCCCCAAATGTGGAGG - Intronic
1019199915 6:170306244-170306266 CGCTCCCTCCCCAAACGTGGCGG + Intronic
1022382245 7:29871325-29871347 CCCTGTCTCCTAAAACTTGGGGG - Intronic
1022932818 7:35138694-35138716 TACTCCTGCCCAAAACCTGGAGG - Intergenic
1022955360 7:35375278-35375300 CACCCTATTCCAAAAGCTGGAGG + Intergenic
1023839563 7:44088681-44088703 CACACTCTCCCAAATGCTGCTGG - Intergenic
1024769637 7:52705599-52705621 CTCTCTCTCCCAAATTCTAGAGG - Intergenic
1025903500 7:65766352-65766374 CACTCTGTCCCCCAAGCTGGAGG + Intergenic
1026260092 7:68747636-68747658 CACTCTCTCCCAAACTTTTGAGG + Intergenic
1029513002 7:101008483-101008505 CCCTGTCTCCCAAAACCCTGAGG - Intronic
1029582050 7:101443204-101443226 CAGTTGCTCCCAAAAGCTGGGGG + Intronic
1029828736 7:103231458-103231480 TACTCCTGCCCAAAACCTGGAGG - Intergenic
1030280413 7:107768910-107768932 CACTCCATCCCAGATCCTGGTGG - Intronic
1031512672 7:122669245-122669267 CGCTCAATCCCAAAAGCTGGAGG + Intronic
1032383498 7:131506228-131506250 CACTCTGTCCCCACACTTGGGGG + Intronic
1032963949 7:137073720-137073742 CATTCTGTCCCAAGACCTGTGGG + Intergenic
1034054655 7:148021794-148021816 CCCTCTCCCCCAAAACCTGGAGG + Intronic
1034275338 7:149821496-149821518 CACTCGCTCCCGCACCCTGGGGG + Intergenic
1034324692 7:150220141-150220163 CACTCCCTCCACAAACCTGCCGG + Intergenic
1034768500 7:153749090-153749112 CACTCCCTCCACAAACCTGCCGG - Intergenic
1036920656 8:12851242-12851264 TGCTCTTTCCCAAAGCCTGGAGG + Intergenic
1037694700 8:21213430-21213452 CAATCTCACCCAAAAGCTGGTGG - Intergenic
1037767241 8:21779859-21779881 CCCTCCCTCCCAGCACCTGGAGG + Intronic
1038191372 8:25324121-25324143 CACTCTCTCCAGAAAGCAGGTGG - Intronic
1040291672 8:46128708-46128730 CACCCTGTTCCAAAGCCTGGTGG + Intergenic
1043694545 8:83202836-83202858 CACTCTCTCCCTACAGCTGAGGG + Intergenic
1047465026 8:125104671-125104693 CACTCTCTTGCAAACCCTGCTGG + Intronic
1048111206 8:131470927-131470949 CTCTCTCCCTCAACACCTGGGGG - Intergenic
1048461333 8:134623910-134623932 CAAGCTCTCCCAATACCTTGTGG + Intronic
1049663724 8:143832993-143833015 CACCCTCTCAGGAAACCTGGAGG + Intergenic
1050549683 9:6738464-6738486 CACTCTGTCCCCCAAGCTGGAGG + Intronic
1050650985 9:7776378-7776400 CACTCTCTCACAAGACATGGAGG - Intergenic
1051855306 9:21559188-21559210 CTCTCTGTCCCTAAACCTCGAGG - Intergenic
1053315664 9:37049279-37049301 CAGCTTCTCCAAAAACCTGGGGG - Intergenic
1055122239 9:72674734-72674756 CCCTGTCTCCCAAATCCTGGAGG - Intronic
1055563000 9:77540146-77540168 CACAATCTACCAAAACCTGTGGG - Intronic
1058449643 9:105084120-105084142 CAATCTCTCCAAAAATTTGGAGG + Intergenic
1059276930 9:113105576-113105598 CAGTGTTTCCCAAGACCTGGAGG - Intergenic
1059279321 9:113118975-113118997 CAGTGTTTCCCAAGACCTGGAGG + Intergenic
1060548353 9:124473806-124473828 CACTCTCAGCCAAGACCTGACGG + Intronic
1061846381 9:133390809-133390831 CCCCCTCTCCCACAACCTGGGGG - Intronic
1189907655 X:45778109-45778131 CACTCCCTCCCAAAGCGAGGCGG + Intergenic
1190988521 X:55522183-55522205 CACTTTGCCCCAACACCTGGAGG - Intergenic
1192193256 X:69010265-69010287 CAAATTATCCCAAAACCTGGTGG + Intergenic
1193331014 X:80236068-80236090 AACTCTCTTCCAAATCCTGTTGG - Intergenic
1195759714 X:108233404-108233426 CTCTCACTCCCAAAACTTGGTGG - Intronic
1196141421 X:112266972-112266994 CACTATCTCCCAACACCTCTAGG + Intergenic
1196831328 X:119777728-119777750 CAAACTATCCCAAAACCTAGTGG - Intergenic