ID: 1077799795

View in Genome Browser
Species Human (GRCh38)
Location 11:5526262-5526284
Sequence CTTCATTAGCTTCTCTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077799793_1077799795 -10 Left 1077799793 11:5526249-5526271 CCAGAGATCCATTCTTCATTAGC 0: 1
1: 0
2: 2
3: 4
4: 116
Right 1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG 0: 1
1: 0
2: 2
3: 17
4: 138
1077799792_1077799795 2 Left 1077799792 11:5526237-5526259 CCATGCTCAAGGCCAGAGATCCA 0: 1
1: 0
2: 1
3: 18
4: 197
Right 1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG 0: 1
1: 0
2: 2
3: 17
4: 138
1077799791_1077799795 11 Left 1077799791 11:5526228-5526250 CCTCTTACTCCATGCTCAAGGCC 0: 1
1: 0
2: 4
3: 60
4: 457
Right 1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG 0: 1
1: 0
2: 2
3: 17
4: 138
1077799790_1077799795 12 Left 1077799790 11:5526227-5526249 CCCTCTTACTCCATGCTCAAGGC 0: 1
1: 0
2: 2
3: 11
4: 216
Right 1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG 0: 1
1: 0
2: 2
3: 17
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077799795 Original CRISPR CTTCATTAGCTTCTCTAGCC TGG Intronic
902344052 1:15802902-15802924 CTTAATTTGCTTCTCTCACCAGG - Intergenic
903187118 1:21634946-21634968 CATCATCTGCTTCCCTAGCCTGG + Intronic
904241894 1:29152549-29152571 CTATATTAGCTTCTCTACTCTGG + Intronic
904418707 1:30377982-30378004 CTTAATAAGCTTCTATAGACTGG - Intergenic
905225539 1:36476476-36476498 CTTCAATAGCTCCTGTGGCCTGG + Intronic
906014944 1:42568032-42568054 CTTGATTAGCTCCTTTGGCCAGG + Intronic
908652940 1:66355964-66355986 CTCCATTAGCTTCTCTGACATGG + Intronic
911426093 1:97714626-97714648 CTTTTTTAACTTCTGTAGCCAGG - Intronic
914885273 1:151579515-151579537 CTTCATTAGCTTTTCTACAAAGG - Intronic
914945994 1:152066739-152066761 TTTTATTTGTTTCTCTAGCCTGG - Intergenic
914993203 1:152516024-152516046 CTTCATTCGTTTCTCCACCCAGG + Intronic
918283977 1:183033992-183034014 CTTTATAAGTTTCTCCAGCCAGG - Intronic
918326900 1:183418512-183418534 CTTCCTTCGCATCTCTCGCCTGG + Exonic
919810075 1:201403533-201403555 GTTCAAGAGCTTCTCTACCCAGG - Intergenic
921886372 1:220310902-220310924 TTTCAATAGCTTCTCTAGGCAGG - Intergenic
923176626 1:231472777-231472799 CTTCACTAGCCTCTATTGCCTGG - Intergenic
923657243 1:235928410-235928432 CTTTATTTCCTTCTCTTGCCTGG + Intergenic
1063158565 10:3402065-3402087 CTTCTTCAGCCTCTCTAGCCTGG + Intergenic
1063381773 10:5590275-5590297 CTTGATCAGATTCTCTAGTCTGG - Intergenic
1067541343 10:47156858-47156880 CTTCATTCACTTCTCCTGCCTGG + Intergenic
1068094288 10:52471216-52471238 ATTCATTATCTTCTTTACCCAGG - Intergenic
1069378453 10:67818371-67818393 CATCAATATCTTCTCTAGGCAGG - Intronic
1070085366 10:73231816-73231838 TTTGATTGTCTTCTCTAGCCAGG - Intronic
1070364457 10:75722883-75722905 TTTCATTAACTTATATAGCCTGG + Intronic
1071218610 10:83436461-83436483 CTTCATTAGCTTTTCTCTGCAGG + Intergenic
1073800673 10:107038224-107038246 CTTCATAAGCTTCCCTAGATGGG + Intronic
1077343383 11:2035845-2035867 CATCATCAGCTTCTCTAGAAGGG + Intergenic
1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG + Intronic
1080976701 11:37350786-37350808 CTTCAGGACCTTCTCCAGCCCGG - Intergenic
1083507394 11:63171317-63171339 CTTCATTTCCTTCTCTTGCCTGG - Intronic
1086111678 11:83206061-83206083 CTTCATTGGCTGCTCTGGCATGG + Exonic
1086947640 11:92859041-92859063 CTTCATTAACTTCTCATGCATGG + Intronic
1087218760 11:95523002-95523024 CTTCATTACTTTCTCTTTCCTGG - Intergenic
1088483548 11:110319620-110319642 CTTTATTTGTTTCTCTTGCCCGG + Intergenic
1088829934 11:113528385-113528407 CTTCATTGGCTTTTTTGGCCAGG - Intergenic
1089655477 11:119943959-119943981 CTTCCTTTCCTTCTCTGGCCAGG + Intergenic
1090156356 11:124442281-124442303 CTTCATTATCTTCTATAGAGAGG - Intergenic
1202826369 11_KI270721v1_random:91034-91056 CATCATCAGCTTCTCTAGAAGGG + Intergenic
1092570277 12:9714066-9714088 CTTCATAAGAGTCTCTTGCCAGG + Intergenic
1092664059 12:10774450-10774472 CTTCATTATCTTCTCTGGCAGGG - Intergenic
1096257385 12:50071804-50071826 CTTAAAGACCTTCTCTAGCCAGG - Intronic
1099903354 12:88740311-88740333 CTTCTTTATCTTCTCTATCTTGG + Intergenic
1100943824 12:99756099-99756121 CTTTATTTCCTTCTCTTGCCTGG - Intronic
1101514238 12:105419680-105419702 CCTCATGAGTTTATCTAGCCAGG + Intergenic
1102063237 12:109951212-109951234 CTTCATTAGCTGCTGTATCTTGG + Exonic
1103138275 12:118526735-118526757 GTCCATGAGCTTCTCAAGCCAGG - Intergenic
1105005098 12:132716681-132716703 CTGCATTTCCTTCTCTAGGCAGG - Intronic
1109551374 13:63905460-63905482 CTTCTCTAGATTCTCTAGGCTGG - Intergenic
1109938159 13:69321600-69321622 TTTCTTTAGCTTATCTACCCAGG + Intergenic
1114008216 14:18335919-18335941 CTTAAATACCTTCTCTAACCAGG - Intergenic
1115312143 14:31989777-31989799 CTTCTTTGACTTCTATAGCCTGG - Intergenic
1116268985 14:42736174-42736196 CTTGATTGGCTTCTCTGGTCTGG - Intergenic
1117342358 14:54803347-54803369 CTTCTTTAGCCTCTCGAGCCTGG - Intergenic
1117744067 14:58849881-58849903 CTGCATTATCTTCTGTATCCTGG - Intergenic
1120719048 14:87870567-87870589 CTTCACTGGCTTCTCTGCCCAGG - Intronic
1122616352 14:103020518-103020540 CATCCATACCTTCTCTAGCCTGG - Intronic
1125956144 15:43792462-43792484 CTTCCGTAGCTTCCCTAGCAAGG + Intronic
1127324694 15:57883716-57883738 CCTCATCAGCTTCTCTGTCCTGG + Intergenic
1127743828 15:61942977-61942999 CTTCATTTGGCTCTCTAGCTTGG - Intronic
1128964218 15:72041329-72041351 CTTCATCAGCTTCTGTCGGCAGG + Intronic
1129600752 15:76996772-76996794 CTCCATTGGCTTCTCTGGGCTGG - Intronic
1137522556 16:49207270-49207292 CCTCATTAGATTCTGTAGACAGG - Intergenic
1138243088 16:55444961-55444983 CTTCATTCACTTGTCTACCCAGG - Intronic
1139493555 16:67300267-67300289 CTTCATTAGCCTCTCAGGGCAGG - Intronic
1139619546 16:68126453-68126475 CTTCATTACCTCCACTAGACTGG + Exonic
1139969482 16:70765002-70765024 GGACATGAGCTTCTCTAGCCAGG - Intronic
1144574874 17:16423093-16423115 CTGCCTTAGCTTCTCGAGCTGGG + Intronic
1145873322 17:28294887-28294909 CTTCATTATCTTCTCTCTCCTGG + Intergenic
1146311661 17:31773498-31773520 TTTCATTAGCTTGTCTAGACTGG - Intergenic
1150576437 17:66434742-66434764 CTTGCTTAACTTCTCTTGCCTGG + Intronic
1151361395 17:73591331-73591353 CTTCTTCAGCTTCTCGAACCTGG + Intronic
1153251923 18:3131390-3131412 CTTCAATAGCTTCTGAATCCTGG + Exonic
1154005549 18:10524573-10524595 CTTCATTTGGTTGTCTAGCCTGG - Intergenic
1158441509 18:57478791-57478813 GTTCATTATCTCCTCTTGCCTGG + Exonic
1160050444 18:75428476-75428498 CATCATGAGCTTCTGTAGGCTGG - Intergenic
1160836267 19:1126136-1126158 GTTCATTAGCATCACTAGCCTGG - Intronic
1161811028 19:6471464-6471486 CTTGTTGAGCTTCTCCAGCCGGG + Exonic
925836813 2:7954141-7954163 CTTGATTCCCTTCTCTACCCAGG - Intergenic
926652867 2:15365324-15365346 CTTTGTTAGCTTCTGTGGCCTGG + Intronic
928415767 2:31090340-31090362 CTGTATTTCCTTCTCTAGCCAGG + Intronic
930554427 2:52877462-52877484 CTTCCATAGCTACTCTAGCCAGG - Intergenic
931658014 2:64527784-64527806 CTGCATTAACTTCCCTTGCCTGG + Intronic
935639852 2:105280381-105280403 CTTTTTGTGCTTCTCTAGCCAGG + Exonic
940685041 2:156838195-156838217 TCTCATTTGCTTCTCTAGCAGGG + Intergenic
940749058 2:157603328-157603350 CTTGATTATCTTCTCCAGTCAGG - Intronic
945163877 2:206921604-206921626 CCTCCTTTGCTTCTCTACCCAGG - Intergenic
945506122 2:210642375-210642397 AATCATTAGCTTCCTTAGCCTGG + Intronic
1169249163 20:4046865-4046887 CTTCATTGTCTTCTCTAGCCAGG - Intergenic
1170422774 20:16208915-16208937 CTTTATTAGCTTCTCTCCCCTGG - Intergenic
1173449873 20:43153876-43153898 CTTCATTCGCTCCTCTTTCCTGG - Intronic
1175872775 20:62216330-62216352 CTTCATGCGCTTCTCCAGCGAGG + Exonic
1180432721 22:15266736-15266758 CTTAAATACCTTCTCTAACCAGG - Intergenic
1181161751 22:20963933-20963955 CTTCAGAATCTCCTCTAGCCAGG - Intergenic
1183062771 22:35346056-35346078 CTCGGTTAGCCTCTCTAGCCTGG - Intronic
949699730 3:6742642-6742664 CTTCATGAGCTTCTCTTCCCTGG + Intergenic
956004059 3:64760421-64760443 CTGAAATAGCCTCTCTAGCCAGG + Intergenic
958446410 3:94220824-94220846 TTTCATTACCGTCTTTAGCCTGG - Intergenic
959017162 3:101147892-101147914 CTCCATTATTTTCTCTAGCTTGG - Intergenic
959520032 3:107315276-107315298 CTTCTCCAGCTTCTCTAGCAAGG + Intergenic
959905577 3:111708016-111708038 CTTCATTAGCTTCTTCACCAAGG - Exonic
961188654 3:124938658-124938680 CATCAAGAGCCTCTCTAGCCAGG + Intronic
962118314 3:132535340-132535362 TTTCCATAGGTTCTCTAGCCTGG + Intronic
963261992 3:143202171-143202193 CTTAATTGGCTTCTCTGGCCAGG + Intergenic
964966754 3:162503657-162503679 CTTTATTTCCTTCTCTTGCCTGG - Intergenic
965077623 3:163999511-163999533 CTTCATTAGCTTGTCTGTCAGGG + Intergenic
966070552 3:175872316-175872338 CTTTATTTCTTTCTCTAGCCTGG + Intergenic
966270405 3:178097897-178097919 CTGCATTTGCTTCTCCTGCCAGG - Intergenic
967417087 3:189230959-189230981 CTCCATTGGCTTCTCTGGCTAGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971854731 4:32028476-32028498 ACTCATTAGCTTTTCTAGACAGG + Intergenic
974309427 4:60186066-60186088 CTTCACTAGCCACTCTATCCTGG + Intergenic
976480183 4:85534076-85534098 CTTCACCAGCTTCCCTAGACTGG - Intronic
978079964 4:104580198-104580220 CATCTTTAGCTTCTATAGCCAGG - Intergenic
978746605 4:112201904-112201926 CTTCTTCAGCTTCTTGAGCCTGG - Intergenic
979467390 4:121056323-121056345 CTTCCTTACTCTCTCTAGCCTGG - Intronic
990799814 5:59587812-59587834 CTTGTTTAGCTTTTCTTGCCTGG - Intronic
992562315 5:77964780-77964802 CTTCCTTAGTGTCTCTAGCAAGG - Intergenic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
997803333 5:136888837-136888859 CTTCATTAGCCTCTCTGCCTTGG + Intergenic
999563401 5:152830022-152830044 CTTCATTAACTGCTCTAGAAAGG - Intergenic
1001478040 5:172064892-172064914 CTTCTTTGGTTTCTCTGGCCCGG - Intronic
1003625123 6:7734448-7734470 CTTCATTATCCACTCCAGCCTGG - Intronic
1004817091 6:19323285-19323307 GTTCAAGAGCTTCTCTATCCAGG + Intergenic
1004993314 6:21163330-21163352 CATCATTAGCTGCTTTAGACTGG + Intronic
1011392498 6:86869097-86869119 GATCATTAGCTTCTCTAGCAAGG - Intergenic
1022012584 7:26321718-26321740 CTTCATTATCTTCTCCATCAGGG + Intronic
1022245010 7:28550699-28550721 CCTCATTGGCTTCACTAGCATGG - Intronic
1023157594 7:37266206-37266228 CTTTATTAGTTTCTCAAACCAGG + Intronic
1023402994 7:39804007-39804029 CTTAATCTGCTTCTCTAACCAGG - Intergenic
1023515176 7:40994589-40994611 CTTCTGTACCTTCTCTGGCCAGG - Intergenic
1024646342 7:51374130-51374152 CTTAATCTGCTTCTCTAACCAGG + Intergenic
1028857824 7:95611983-95612005 CTTCATTCCCTCCTATAGCCAGG + Intergenic
1029003689 7:97184220-97184242 CTTCACCTGCTGCTCTAGCCAGG + Intergenic
1029866626 7:103638308-103638330 CCTCATTAGCATCTCTAACAGGG + Intronic
1030581785 7:111365417-111365439 ATTCAATAGCTGCTCTAGCGTGG - Intronic
1031390381 7:121206184-121206206 CTTCATTAGCATCTCAAGGAAGG - Intronic
1031750908 7:125572670-125572692 CTGCATTTGCTTCTCTGTCCTGG - Intergenic
1033437704 7:141348642-141348664 TTTCATTAGCTTAACTAGACTGG - Intronic
1035276474 7:157750972-157750994 CATCTTTAGCTTCTCTAGAAAGG + Intronic
1036422866 8:8614080-8614102 CTTCATCAGCTTCTTTGTCCTGG - Intergenic
1043002311 8:74773958-74773980 CTACATTAGCTTTTCTTTCCTGG + Intronic
1044704297 8:94993720-94993742 CTTCTTTAGCTTGTCTTACCTGG - Intronic
1047230761 8:122996110-122996132 ATTCATTTGCTCCTTTAGCCTGG - Intergenic
1048235102 8:132682290-132682312 CTACATTGGCTTCTCCAGCACGG - Intergenic
1050642008 9:7678304-7678326 CTTCATTTGTTTCTTTAGTCTGG - Intergenic
1051946508 9:22575610-22575632 CTTTATTTCCTTCTCTTGCCTGG - Intergenic
1055581656 9:77712533-77712555 CTTTATTGGCTTCTCTCTCCTGG - Intergenic
1058415602 9:104785474-104785496 CTTCATTATCTTCTCTGGCCAGG - Exonic
1058675021 9:107392922-107392944 CTTCCTTAGCATCTCTCACCTGG + Intergenic
1060312382 9:122473887-122473909 ATTCATTGGCTTCTCTTGCCAGG + Intergenic
1185919809 X:4078712-4078734 CTTCAATTGCTTCTCTGGCTAGG + Intergenic
1187566095 X:20451142-20451164 TTTCATTATCTTCTCTTGCCTGG + Intergenic
1189338251 X:40184273-40184295 CTTCCGTAGCTTCTCCAGCATGG + Intergenic
1192076171 X:67999804-67999826 GTTCATTAGCTTCTTTGGCTTGG + Intergenic
1192509528 X:71713674-71713696 CCTCCTTAGCTTCAGTAGCCAGG - Intergenic
1192517169 X:71767879-71767901 CCTCCTTAGCTTCAGTAGCCAGG + Intergenic
1193862279 X:86684395-86684417 ATTCATTAGCTTCTAAAGCATGG + Intronic
1198994035 X:142552810-142552832 CATGATTTGCTTTTCTAGCCTGG - Intergenic