ID: 1077802161

View in Genome Browser
Species Human (GRCh38)
Location 11:5550649-5550671
Sequence AGGGTGCCTGCACTCAGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077802161 Original CRISPR AGGGTGCCTGCACTCAGCCG GGG Intronic
900408545 1:2502809-2502831 AGGGTGCCTGCAGGCAACCGGGG + Intronic
902601506 1:17542828-17542850 AAGGCGCCAGCACTCAGCCTGGG + Intronic
904738233 1:32651355-32651377 TGGGTGCCTGGGCTGAGCCGCGG + Intronic
905434272 1:37946314-37946336 AGGGTGTGTGCGCTCAGCAGGGG - Exonic
906250113 1:44304714-44304736 GGGGAGCATGCACTCAGCAGGGG - Intronic
906346575 1:45019324-45019346 GGGGAGCCTGAGCTCAGCCGTGG + Intronic
911686284 1:100780803-100780825 AGGGTGCCTGCCCCAAGCCTTGG - Intergenic
912162427 1:107001763-107001785 AGGGCTCCTGCACTCAGGCTGGG - Intergenic
915459438 1:156061059-156061081 TGGGTGTCTGCTCTCAGCCTGGG - Intergenic
916575788 1:166065172-166065194 AGGGTGCCTGCATTTAACCAGGG + Intronic
919971704 1:202584626-202584648 AGGGTGCCGACACTCACCAGTGG - Exonic
920952139 1:210582381-210582403 CGGTTTCCTGCACTGAGCCGAGG - Intronic
923099025 1:230797705-230797727 AGCGTGCCAGCACTGAGCTGGGG - Intronic
924038102 1:239956346-239956368 AGGGGGCCGGCTGTCAGCCGAGG - Intergenic
1063006393 10:1975099-1975121 ATGGAGGCTGCACTGAGCCGTGG - Intergenic
1063077926 10:2734939-2734961 AGGCTGCCCGCACTCATCAGCGG - Intergenic
1064980697 10:21163590-21163612 AGGATGACTGAACTCAGCCAAGG - Intronic
1065889227 10:30106922-30106944 GGGCTGCCTGCACCCAGCCGTGG - Intronic
1067082185 10:43218029-43218051 AGGGTGCCGGCTCCCAGCTGGGG - Intronic
1069837936 10:71320797-71320819 AGGGTGCCTGCAGTGTGCCTGGG + Intronic
1069857371 10:71448781-71448803 TGGGTGCCAGCACCCAGCAGAGG - Intronic
1071549692 10:86557129-86557151 AGGGAGCGTGCACTCACCTGCGG + Intergenic
1071971867 10:90915974-90915996 AGGGTGCCTGCACACAGCATGGG + Intronic
1076189154 10:128470572-128470594 GGGGTGCCTGCGCTCAGCACTGG - Intergenic
1076728963 10:132428957-132428979 AGGGTGCCTGCTCTGAGCTAAGG - Intergenic
1077802161 11:5550649-5550671 AGGGTGCCTGCACTCAGCCGGGG + Intronic
1078022263 11:7665740-7665762 AGGGTCCCTGCAGTGAGCCTGGG - Intronic
1078669552 11:13352881-13352903 AGGGTGCCTGCCTACAGCCAGGG - Intronic
1084216241 11:67648422-67648444 AGGTCCCCTGCACTCAGCCCTGG + Intronic
1091001479 11:131913481-131913503 AGGGTGGCTGCATTCAGCAGAGG + Intronic
1092020931 12:5201700-5201722 AGGCTCCCTGCACACAGCCAGGG + Intergenic
1094819601 12:34214249-34214271 ATGGTGCCTGCGCACAGCCCAGG - Intergenic
1095095128 12:38143230-38143252 ATGGTGCCTGTACACAGCCCAGG + Intergenic
1097746685 12:63311001-63311023 AGGGTTCCTGGACTCAGAAGTGG + Intergenic
1101072195 12:101087477-101087499 AGGGCCACTGCACTCAGCCTGGG + Intronic
1101309740 12:103565241-103565263 TGGGTGCCTCCACTCATCCTTGG + Intergenic
1101968525 12:109296635-109296657 GGGCTGCCTGCACCCAGCAGGGG - Intronic
1103739879 12:123083981-123084003 GGGGTGACTGCACTCAGGCCAGG + Intronic
1105281258 13:18963932-18963954 AAGCTGCCTGCACTCACCTGAGG + Intergenic
1105290463 13:19049942-19049964 AAGCTGCCTGCACTCACCTGAGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1115010564 14:28540185-28540207 GGGGTCCCTGGACTCAGCCCAGG - Intergenic
1118301811 14:64623174-64623196 ATGGTTCCTGCCCTCAGCCATGG - Intergenic
1119168230 14:72513494-72513516 AGGGAGCCTGCACCCAGCTCAGG - Intronic
1122172822 14:99890630-99890652 AGGGTGACTGAAGTCAGCAGGGG + Intronic
1122742926 14:103882166-103882188 GCGGTGGCTGCTCTCAGCCGGGG - Intergenic
1123113325 14:105882896-105882918 TGGGTGCCTGCACTGAACCTCGG + Intergenic
1124594595 15:31082347-31082369 ACTGTCCCTTCACTCAGCCGGGG - Intronic
1127904741 15:63368319-63368341 ATGGTGCCTGCGCTCCACCGTGG + Intronic
1134210528 16:12272557-12272579 GGGGAGCCTGCACTTAGCCATGG - Intronic
1138490138 16:57371955-57371977 AGGGAGCCTGAAGTCAGCAGGGG - Intergenic
1143018416 17:3904046-3904068 TGGGTGCCTGCACTAAACAGAGG + Intronic
1143263343 17:5616800-5616822 AGGGGGCCTGAACTCACCCTTGG - Intronic
1144733312 17:17541007-17541029 AGGGTGGCTGGACTCAGCACGGG - Intronic
1148566027 17:48633569-48633591 AGGGAGCCTGGACTGGGCCGCGG - Intronic
1148677592 17:49454130-49454152 AGGCTGCCTGGACTCAGCCTTGG + Intronic
1149083592 17:52687138-52687160 TGGGTGCCTGCATTCAGCTGAGG - Intergenic
1152285613 17:79410986-79411008 GGGGTCTCTGCACTCAGCCCAGG - Intronic
1152316448 17:79583429-79583451 ACAGTGACTGCACTCAGCTGGGG + Intergenic
1152442538 17:80317805-80317827 AGGGTGGCTGCCCTCTGCCAGGG + Intronic
1152601696 17:81265607-81265629 ATGGTGCCTGTACCCAGCCCAGG - Intronic
1155057492 18:22197731-22197753 GGGGGGACTGCACTCAGCAGGGG + Intronic
1160534450 18:79584770-79584792 AGGCTGCCTGCTCCCAGCTGGGG - Intergenic
1161543134 19:4864429-4864451 TGAGTCACTGCACTCAGCCGTGG + Intronic
1162017613 19:7853840-7853862 AGGGTGTGGGCACTCACCCGGGG + Intronic
1163234138 19:16021222-16021244 GGGGTGCCAGGACACAGCCGTGG - Intergenic
1163384845 19:16993335-16993357 CAGGTGCCTGCACCCAGCCTGGG + Intronic
1164375079 19:27677216-27677238 AGACTGCCTGCAGTCAGCCAGGG + Intergenic
1164382192 19:27744754-27744776 AGATTGCCTGCAGTCAGCCAGGG + Intergenic
1164392823 19:27840658-27840680 TGGCTGCCTGCACACAGCCAGGG + Intergenic
1166256125 19:41606179-41606201 ATGGTGCCTGCACTCTGACATGG + Intronic
1168136521 19:54355726-54355748 AGGTTTCCTGCCCACAGCCGGGG + Intronic
926796172 2:16620918-16620940 AGGTTGTCTGCACTCAGTCCTGG - Intronic
927254103 2:21024945-21024967 TGGGTGCCCGCACTCTGCAGGGG - Exonic
928936714 2:36686792-36686814 AGAATGCCTGCACACAGCCTGGG - Intergenic
929551749 2:42897707-42897729 AGGGTGCCTGGATCCAGCCCAGG + Intergenic
932713218 2:74082896-74082918 TGGATGCCTGCACTCACCCGTGG - Intronic
933768668 2:85729183-85729205 CCGGAGCCTGCAGTCAGCCGGGG - Intergenic
936993182 2:118387312-118387334 AGGGTGCCAGCACCCAGCTCAGG - Intergenic
937235725 2:120430878-120430900 AGGGTGCCTGGACTGAGTTGTGG + Intergenic
937360344 2:121225187-121225209 AGTGTGCCTGTGCTCTGCCGAGG - Intronic
937951003 2:127387926-127387948 GGGCTGCCTGCCCTCAGCGGCGG - Intronic
938452159 2:131431072-131431094 AGGGAGCCTGCATTCTGCTGAGG + Intergenic
940321733 2:152384637-152384659 AGGCTGCCTCCACTGAACCGAGG - Intronic
943219826 2:185090502-185090524 AGGGTGCAAGCCCTCAGCCTTGG + Intergenic
944606245 2:201354282-201354304 AGGGAGCTTGCAGTCAGCAGAGG + Intronic
944872840 2:203931654-203931676 AGGGAGCCTGAACTCTGCAGAGG + Intergenic
945315044 2:208361348-208361370 TGGGTTCCTGCAGTCAGCTGTGG + Intronic
948893142 2:240916580-240916602 CGGGTGCCTGCAATAGGCCGCGG - Intergenic
1169211561 20:3768523-3768545 TGGGCGCCTGCAATGAGCCGAGG + Intergenic
1171481727 20:25459976-25459998 AGGGTGGCTGCACTCAGGATGGG - Intronic
1174564804 20:51456981-51457003 AGGGTGCCTGGGCTGAGCTGGGG - Intronic
1175132678 20:56801369-56801391 AGCGTCACTGCACTCAGCCTGGG - Intergenic
1175957099 20:62616994-62617016 TGGGTGCCTGGGCTCAGCAGGGG + Intergenic
1175960910 20:62635977-62635999 AGGGCGCCTGCAGGCAGCAGGGG + Intergenic
1176118152 20:63442180-63442202 AGAGAGCCTGAGCTCAGCCGTGG - Intronic
1184714673 22:46274082-46274104 AGGGTGCCAGCTCCCAGCCCAGG - Intronic
1185197732 22:49482892-49482914 TGGATGCCTGGATTCAGCCGTGG + Intronic
1185405324 22:50644938-50644960 AGGATGCCTGCAGCCAGCCTGGG - Intergenic
949726715 3:7056380-7056402 AGGGTGCCTGGCCACAGCCGGGG + Intronic
950111449 3:10421286-10421308 ACAGAGCCTGCACTCAGCCTGGG + Intronic
950262615 3:11553736-11553758 AGGCTGCCTCCCCTCAGCCTGGG + Intronic
950644130 3:14367156-14367178 AGGGAGCCTGCACTCACACGAGG + Intergenic
951835982 3:26983945-26983967 TGGGTGCCTTAACTCAGCCTGGG - Intergenic
954874970 3:53796245-53796267 AGGCAGGCTGCACTCAGCCTAGG - Intronic
955505945 3:59633290-59633312 AGGATCCCTGCACTCAGCTGTGG + Intergenic
959948511 3:112152121-112152143 AGGGGACCTGCACTCAGCATAGG + Intronic
960713374 3:120553024-120553046 GTGGTGCCTGGACTCAGCCTGGG - Intergenic
961645212 3:128389213-128389235 AGGGTGCTGACACTCACCCGAGG + Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962636614 3:137338453-137338475 AGGGTGCAAGCACCCAGCCTTGG + Intergenic
965736585 3:171827054-171827076 AGGGAGCTTGCAGTGAGCCGAGG + Intergenic
968494930 4:910306-910328 AGGGGGACTGCACTTAGCGGGGG - Intronic
968624413 4:1620290-1620312 AGTGTGCCTGGACACAGCTGTGG + Intronic
973617853 4:52697095-52697117 AGCGAGACTGCACTCAGCCTGGG + Intergenic
981487329 4:145301237-145301259 AGGGGGCATGCACTCACCCAGGG - Intergenic
982183020 4:152766039-152766061 AGGGAGGCTGCAGTGAGCCGAGG + Intronic
982521010 4:156416756-156416778 AGGGTGCCAGCCCTAAGCCTTGG - Intergenic
984745781 4:183215296-183215318 AGGTTGCCTGCAGTCAACTGCGG - Intronic
985541855 5:491114-491136 CGGAGGCCTGCGCTCAGCCGTGG + Intronic
985960616 5:3300708-3300730 TGCCTGCCTGCACTCAGCCCTGG - Intergenic
986445486 5:7817173-7817195 AGGCTACCTGCACTCAGTCAAGG + Intronic
987562393 5:19540658-19540680 AGGGTGCAAGCACTAAGCCTTGG - Intronic
988267107 5:28966533-28966555 TGGGCCCCTGCACTCAGCCAAGG - Intergenic
990318510 5:54607257-54607279 AGGGTTCCTGCACACAGGCGGGG - Intergenic
994853470 5:105086574-105086596 AGGGTGTCTGGACTGAGCCGAGG - Intergenic
997337655 5:133119285-133119307 AGGATGGCTGCTCTCAGCCTGGG + Intergenic
998231386 5:140363489-140363511 GCGGTGCCTGTCCTCAGCCGAGG - Exonic
998380120 5:141718313-141718335 ATGGTGCCTGCACAAAGCAGAGG + Intergenic
1001940550 5:175736779-175736801 AGGGTCCCTGAGCTCAGCCCAGG + Intergenic
1011239604 6:85256927-85256949 AGGGTGCCTGCTACCAGCCCAGG + Intergenic
1014405335 6:121043756-121043778 AGGGCGCCGGCACACAGACGAGG - Intergenic
1019774068 7:2901893-2901915 AGGGTGCACGCACACAGACGGGG - Intergenic
1022596369 7:31717409-31717431 AGGTTGCCTGCCTTCAGCCTTGG + Intergenic
1024333729 7:48182083-48182105 AGAGTACCTGCACTCAGCCATGG + Intronic
1024555046 7:50596428-50596450 AGTGTGCCTGGGCTCAGCCTAGG - Intronic
1026188513 7:68103085-68103107 GAGGTGCCTGCACCCCGCCGAGG + Intergenic
1026283077 7:68938951-68938973 AGGCTGTCTGCACTCAGCATTGG + Intergenic
1029887976 7:103893172-103893194 AGGATGCCAGCACTCAGCTAGGG + Intronic
1032478036 7:132225656-132225678 AGCCTGTCTGCACTCAGCCTGGG + Intronic
1033589671 7:142798569-142798591 GGGGTTCCTGCAGTCAGCTGGGG + Intergenic
1035674373 8:1444845-1444867 ACGGTGGTTGCAGTCAGCCGAGG - Intergenic
1036218960 8:6904398-6904420 AGGGTGTGTGTACTCAGCCCAGG + Intergenic
1040578777 8:48677795-48677817 AGGGTGGCAGCACGCAGCCCAGG + Intergenic
1044573402 8:93743907-93743929 ATGGTGGCTGCACTGAGCTGTGG + Intergenic
1047728321 8:127703964-127703986 AAGGTGTCTGCAGTCAGCCTGGG - Intergenic
1049156027 8:141067343-141067365 AGGGTGCCTGGGCCCAGCCCAGG + Intergenic
1049423773 8:142528292-142528314 GGGGTCCCTGCGCTCAGCTGAGG - Intronic
1049589771 8:143452155-143452177 AGGGAGCCTGGACTCAACCCTGG + Intronic
1049782454 8:144435194-144435216 CTGCTGCCTGCACACAGCCGGGG + Intronic
1050255387 9:3787718-3787740 AGGGTGCAAGCACCCAGCCTTGG - Intergenic
1051897714 9:22005995-22006017 AGGGTACCTGCGCACAGCCACGG - Exonic
1052689680 9:31801804-31801826 AGGGTCCCTGAACTCAGCCCAGG - Intergenic
1056709937 9:88984078-88984100 AGGGTGCCTGCAGAGAGCCAGGG - Intergenic
1057274507 9:93669205-93669227 CGGGGGCCTGCACTTAGCCACGG - Intronic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1061205139 9:129158628-129158650 AGGGTGCCTCTGCTCAGCCTGGG - Intergenic
1061836361 9:133332575-133332597 AGGGGGCCTGCACGGAGCCGCGG - Exonic
1062429946 9:136522555-136522577 AGGGTGCCTGCACTGGGGGGAGG + Intronic
1062590470 9:137272366-137272388 AGGGTGCCTGGGCACAGCTGGGG + Intronic
1185885941 X:3782839-3782861 AGGGTGGCTGCACTCACCCCAGG - Intergenic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1191700217 X:64033933-64033955 AGGGTGGCTCAACTCAGCCAAGG - Intergenic
1197752262 X:129973328-129973350 AAGGTGCCTGCTCTCAGATGGGG + Intergenic
1201145151 Y:11060479-11060501 AGGAGGGCTGCACTCAGCGGTGG + Intergenic
1201912695 Y:19149339-19149361 AAGGTGACTGCACTCATCCTGGG + Intergenic