ID: 1077815028

View in Genome Browser
Species Human (GRCh38)
Location 11:5678640-5678662
Sequence CAGGTAACCCATTTTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077815028_1077815031 9 Left 1077815028 11:5678640-5678662 CCTGCATCAAAATGGGTTACCTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1077815031 11:5678672-5678694 TACCTTTCACACAGCTATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077815028 Original CRISPR CAGGTAACCCATTTTGATGC AGG (reversed) Intronic
901332262 1:8419534-8419556 CAGGTAACTTATTTTTATACAGG + Intronic
902367415 1:15985915-15985937 CAGGTAACCCTGATTGATGTGGG - Intergenic
903749877 1:25615089-25615111 CATGTGACCCATTTGGGTGCAGG - Intergenic
904409318 1:30315447-30315469 CAGGTCAGCCATTAGGATGCAGG - Intergenic
915487808 1:156234244-156234266 CAGGTAAGCCATGTTGTTGAGGG + Intronic
916024564 1:160822657-160822679 GAAGTAGCCCATTTTGATACAGG - Intronic
917951458 1:180041246-180041268 CAGGTAACTTATTTTGCAGCAGG + Exonic
921372556 1:214439512-214439534 ACGGTAACTCATTTTTATGCTGG + Intronic
921811025 1:219514619-219514641 CAGGGTACACATTTTGTTGCAGG + Intergenic
1063158678 10:3403311-3403333 CAGCTACCTCTTTTTGATGCAGG + Intergenic
1065153135 10:22842666-22842688 CAGGGAACCCATTTTAATGGTGG + Intergenic
1069627084 10:69875010-69875032 CAGCTAACCCAGTTTGCAGCGGG - Intronic
1070097668 10:73353802-73353824 CTGGTAACCCATTTTGATTTGGG + Intronic
1070182300 10:74025922-74025944 CTGGTAACCCATTTTTCTCCAGG - Intronic
1072880651 10:99224544-99224566 CATCTAATCCATTTTGATGAAGG + Intronic
1075585500 10:123654789-123654811 AAGATAACCTATTTTAATGCTGG + Intergenic
1076003723 10:126931670-126931692 CAGGGAAGCCATTCTGAAGCGGG + Intronic
1077815028 11:5678640-5678662 CAGGTAACCCATTTTGATGCAGG - Intronic
1077938670 11:6817089-6817111 CTGCTGACCCATTTTGATGGAGG - Intergenic
1080826277 11:35851798-35851820 CCTGTAACCTAATTTGATGCAGG - Intergenic
1085664225 11:78399109-78399131 CCTCTAACCCATTTTTATGCTGG - Intronic
1087782977 11:102320458-102320480 CAAGTCACCCAGTTTGAGGCTGG + Intronic
1087903278 11:103666615-103666637 CATGTAACCCTTTATGAGGCAGG + Intergenic
1093265349 12:16997049-16997071 CAGTTACCCCAGTTTGATTCAGG - Intergenic
1093685608 12:22050237-22050259 CAGTTAACACATGGTGATGCTGG - Intronic
1094555381 12:31494398-31494420 CTGGTAACTCATTATGAGGCAGG + Intronic
1096408373 12:51359874-51359896 CAGGTGACCCTTTTCTATGCTGG + Intronic
1101056415 12:100920556-100920578 CAAATAACCCATTTTAATTCTGG + Intronic
1101062708 12:100988497-100988519 CAGGTAAGTCATTTTTATGGAGG - Intronic
1102948062 12:117007425-117007447 CAGCTAAACCATGTTGAGGCTGG - Intronic
1106008660 13:25796483-25796505 CATGAAACCCATTTTAATGAAGG + Intronic
1106171895 13:27295749-27295771 CAGATAAGCCAGTTTAATGCTGG - Intergenic
1109415306 13:62031737-62031759 CAAGTAGCCCATTTGGATCCTGG + Intergenic
1109773652 13:67010544-67010566 CAGCTAACAGATTTTGATGATGG + Intronic
1114720739 14:24879385-24879407 CCGGTAATCCATTTTGATACTGG + Intronic
1123455984 15:20426657-20426679 CAGGAAACCCATTGAGATTCAGG - Intergenic
1123635586 15:22304180-22304202 CAGGAAACCCATTGAGATTCAGG + Intergenic
1127849504 15:62900833-62900855 CAGGTAATCCATATTCATGGTGG - Intergenic
1130819261 15:87476893-87476915 TAGGCAACTCATTTTGATGTTGG - Intergenic
1134660863 16:15983445-15983467 CAGGAAACCTATTTGGAGGCTGG + Intronic
1138220273 16:55244415-55244437 CTGGCAACCCATTTTGCTACAGG - Intergenic
1138366337 16:56480809-56480831 CAGGACACCCATTTCCATGCAGG - Intronic
1140812394 16:78591022-78591044 CAGATAACACATTTTCATACTGG - Intronic
1146212078 17:30950574-30950596 CTGGAAAACCATTTTAATGCTGG + Intronic
1150218570 17:63483497-63483519 AACGAAACCCACTTTGATGCTGG + Intergenic
1157484132 18:48075009-48075031 TAGATGACCTATTTTGATGCTGG - Intronic
1158461366 18:57648814-57648836 CACCTGCCCCATTTTGATGCAGG + Intronic
1160012318 18:75115544-75115566 CAGGTATCCCCTGTTGCTGCTGG + Intergenic
1160426033 18:78779941-78779963 CAAGTCACCCATTTTAAAGCTGG + Intergenic
1161252235 19:3286314-3286336 AAGGAAACCCTTTTTGAGGCTGG + Intronic
1168517905 19:57023739-57023761 CTGGTAACGTATTTTGGTGCTGG + Intergenic
926014581 2:9438377-9438399 CTGGCAACCCAATTTGATGGTGG - Intronic
929307214 2:40377162-40377184 CAGGTAACCCATTAAGAAGAGGG + Intronic
936660329 2:114536126-114536148 CAGGCAAACCATGTCGATGCAGG - Intronic
936681284 2:114775199-114775221 CTGTTAACCCAACTTGATGCAGG + Intronic
939684466 2:145181599-145181621 CATGTAACATATTTTAATGCTGG + Intergenic
943096338 2:183434110-183434132 CACATAACCCAAATTGATGCTGG - Intergenic
945989361 2:216380772-216380794 CACGTAACCCATTTTAACACAGG + Intergenic
947317878 2:228881649-228881671 CTGGAAACCAATTTTGATGTTGG - Intronic
1172463157 20:35135277-35135299 CAGGTAACTTATTGTGATGCAGG + Intronic
1178970104 21:37166969-37166991 CAGGTAAGGCACTGTGATGCAGG - Intronic
1181610706 22:24009662-24009684 CAGGTTGCCCATTATGAGGCTGG - Intergenic
1183560112 22:38565719-38565741 AAGCTAACCCATACTGATGCAGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
952572386 3:34732348-34732370 CAGGTGACACCTTCTGATGCAGG + Intergenic
955379857 3:58429132-58429154 CTGTTAACTCATTTTGATGAGGG - Intronic
960239351 3:115322337-115322359 TAGGCAACCCATTTCAATGCTGG - Intergenic
964061331 3:152527954-152527976 CATGTGACTCATTTTGTTGCAGG - Intergenic
965803191 3:172515375-172515397 TATGTATCCCATTTTGAAGCTGG + Intronic
967640701 3:191859561-191859583 CAGATAGCCCATTTTGATTTGGG - Intergenic
968610895 4:1556562-1556584 CAGGTACCCCCTGGTGATGCTGG + Intergenic
972402452 4:38718301-38718323 AAGGAAACCCATGCTGATGCGGG - Intergenic
973994290 4:56440959-56440981 AAGGAATCCAATTTTGATGCTGG - Intronic
974663182 4:64921481-64921503 CAGTTAACCCATTTACATTCAGG - Intergenic
979897439 4:126176980-126177002 AAGATAAGACATTTTGATGCAGG - Intergenic
984518311 4:180769558-180769580 CAGATAATCCATTTGGAGGCAGG + Intergenic
986209533 5:5657597-5657619 CAGGTGACAGATTCTGATGCAGG - Intergenic
987086751 5:14477119-14477141 CAGGTAACTCATGTTGAAGAAGG - Intronic
993822395 5:92634752-92634774 CATTTTAACCATTTTGATGCTGG - Intergenic
995467409 5:112465362-112465384 CAGGTACACCATTCAGATGCAGG + Intergenic
997214718 5:132101260-132101282 CAGGTACCCGATATTGATGTGGG - Intergenic
998487102 5:142512447-142512469 CAGGCAGCCCATTTGGAGGCCGG - Intergenic
1007304636 6:40894397-40894419 CAGGTGACGCATTGTCATGCCGG - Intergenic
1008737435 6:54562905-54562927 CAGATGACACATTTTGATGGAGG - Intergenic
1009347228 6:62629028-62629050 CACGTAGCACATTTTGGTGCAGG + Intergenic
1011082364 6:83503563-83503585 CAGGTAACCCTTCCTGATGTGGG - Intergenic
1012139450 6:95604510-95604532 CAGGTCACCCAGTTTGTTGGAGG - Intronic
1012316412 6:97786366-97786388 CAGATACACCATTTTGATGTTGG - Intergenic
1017834672 6:158166928-158166950 CAGGTAACTAATTTTGGTGGGGG - Intronic
1026877858 7:73890036-73890058 CAAGGAAGCCATTTTGATGCAGG - Intergenic
1028971946 7:96868976-96868998 CAGGTAACCTAATTTCATGAAGG - Intergenic
1033654710 7:143364910-143364932 CACTTATCCCATTTTGAAGCTGG + Intergenic
1037520002 8:19671400-19671422 GAGGTAACCCATTTTTATTATGG + Intronic
1045812039 8:106232914-106232936 CAGGTGACCAATTATAATGCTGG + Intergenic
1047002738 8:120589177-120589199 CATGTAACTCATTCTGATACTGG + Intronic
1048110919 8:131467677-131467699 GAGAGAACCAATTTTGATGCTGG - Intergenic
1048543151 8:135361438-135361460 CCTGGAACCCATTTTGCTGCTGG + Intergenic
1055270916 9:74557331-74557353 CAGGTAACCCCAGTTGCTGCTGG + Intronic
1056531646 9:87493324-87493346 CAGGTAACTCAGTCTGATGAGGG - Intergenic
1060840367 9:126788724-126788746 CAGCTGACACATTTAGATGCAGG - Intergenic
1187828503 X:23356967-23356989 TAGTAATCCCATTTTGATGCTGG + Intronic
1193889228 X:87022738-87022760 CAGTTAAGCCATATTGATGTGGG - Intergenic
1199972915 X:152873720-152873742 CAGGTCACCCATTCAGATCCAGG + Intergenic