ID: 1077817159 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:5697126-5697148 |
| Sequence | GTTTACAGAAACAGTGAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 268 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 20, 4: 245} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077817159_1077817163 | 28 | Left | 1077817159 | 11:5697126-5697148 | CCAGCCTCACTGTTTCTGTAAAC | 0: 1 1: 0 2: 2 3: 20 4: 245 |
||
| Right | 1077817163 | 11:5697177-5697199 | TTCCTTGCTGTCCTCTATTCAGG | 0: 1 1: 0 2: 1 3: 25 4: 241 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077817159 | Original CRISPR | GTTTACAGAAACAGTGAGGC TGG (reversed) | Intronic | ||