ID: 1077817159

View in Genome Browser
Species Human (GRCh38)
Location 11:5697126-5697148
Sequence GTTTACAGAAACAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077817159_1077817163 28 Left 1077817159 11:5697126-5697148 CCAGCCTCACTGTTTCTGTAAAC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1077817163 11:5697177-5697199 TTCCTTGCTGTCCTCTATTCAGG 0: 1
1: 0
2: 1
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077817159 Original CRISPR GTTTACAGAAACAGTGAGGC TGG (reversed) Intronic