ID: 1077817163

View in Genome Browser
Species Human (GRCh38)
Location 11:5697177-5697199
Sequence TTCCTTGCTGTCCTCTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077817160_1077817163 24 Left 1077817160 11:5697130-5697152 CCTCACTGTTTCTGTAAACTAGT 0: 1
1: 0
2: 0
3: 18
4: 163
Right 1077817163 11:5697177-5697199 TTCCTTGCTGTCCTCTATTCAGG 0: 1
1: 0
2: 1
3: 25
4: 241
1077817159_1077817163 28 Left 1077817159 11:5697126-5697148 CCAGCCTCACTGTTTCTGTAAAC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1077817163 11:5697177-5697199 TTCCTTGCTGTCCTCTATTCAGG 0: 1
1: 0
2: 1
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077817163 Original CRISPR TTCCTTGCTGTCCTCTATTC AGG Intronic