ID: 1077821253

View in Genome Browser
Species Human (GRCh38)
Location 11:5743635-5743657
Sequence TTGGATACACAACAAAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1999
Summary {0: 1, 1: 0, 2: 17, 3: 191, 4: 1790}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077821252_1077821253 -5 Left 1077821252 11:5743617-5743639 CCTGCTTCTGAATAATCTTTGGA 0: 1
1: 0
2: 14
3: 99
4: 555
Right 1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG 0: 1
1: 0
2: 17
3: 191
4: 1790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077821253 Original CRISPR TTGGATACACAACAAAATCA AGG Intronic
903490497 1:23724503-23724525 TAGGAAACACACCAAAATGATGG - Intergenic
904988071 1:34569318-34569340 CTGGGTACATAACAAAATGAAGG - Intergenic
905355208 1:37378265-37378287 CTGGGTACATAACAAAATGAAGG - Intergenic
905726938 1:40259955-40259977 ATGGATACCAAACAAAATAATGG - Intronic
906571876 1:46849074-46849096 CTGGGTACATAACAAAATGAAGG + Intergenic
906851935 1:49260058-49260080 CTGGGTACATAACAAAATGAAGG + Intronic
906854091 1:49285271-49285293 CTGGATACATAACGAAATGAAGG + Intronic
906876932 1:49549519-49549541 TTGGGTCAAAAACAAAATCAAGG - Intronic
906878534 1:49564547-49564569 CTGGGTACATAACAAAATGAAGG - Intronic
906923754 1:50092216-50092238 TTGGAAACACAAAAAGAGCATGG + Intronic
907139572 1:52174244-52174266 CTGGGTACATAACAAAATGAAGG - Intronic
907435804 1:54446506-54446528 CTGGGTACATAACAAAATGAAGG - Intergenic
907624346 1:56013725-56013747 TTGGGTAAATAACAAAATTAAGG + Intergenic
907648683 1:56271567-56271589 CTGGATACATAACGAAATGAAGG + Intergenic
907780999 1:57566176-57566198 CTGGGTACATAACAAAATGAAGG + Intronic
908068954 1:60437429-60437451 CTGGGTACATAACAAAATGAAGG + Intergenic
908099452 1:60775773-60775795 CTGAATACATAACAAAATGAAGG - Intergenic
908099887 1:60779724-60779746 CTGGGTACATAACAAAATGAAGG + Intergenic
908278936 1:62508578-62508600 TTGGAAACACAACAAATTTGGGG + Intronic
908294755 1:62702638-62702660 CTGGGTACATAACAAAATGAAGG - Intergenic
908575302 1:65453520-65453542 CTGGGTACATAACAAAATGAAGG - Intronic
908631041 1:66107178-66107200 CTGGGTACATAACAAAATGAAGG - Intronic
908637825 1:66188075-66188097 CTGGGTACATAACAAAATGAAGG - Intronic
908639065 1:66202087-66202109 CTGGGTACATAACAAAATGAAGG - Intronic
908972599 1:69855366-69855388 CTGGGTACATAACAAAATGAAGG - Intronic
908974894 1:69885857-69885879 CTGGATACATAACGAAATGAAGG - Intronic
908976788 1:69908503-69908525 CTGGATACATAACAAAATGAAGG - Intronic
908978464 1:69926041-69926063 CTGGGTACATAACAAAATGAAGG - Intronic
909267496 1:73579140-73579162 TTGGGTAAACAACAAAATCAAGG + Intergenic
909343268 1:74555378-74555400 CTGGGTACATAACAAAATGAAGG + Intergenic
909390039 1:75110101-75110123 CTGGGTACATAACAAAATGAAGG - Intergenic
909695366 1:78462650-78462672 TTGGATAAACAATGAAATTAAGG - Intronic
909816076 1:79995238-79995260 TTAAATAGACATCAAAATCAAGG + Intergenic
910067449 1:83170320-83170342 CTGGGTACATAACAAAATGAAGG + Intergenic
910379557 1:86611699-86611721 CTGGGTACATAACAAAATGAAGG - Intergenic
910381459 1:86631202-86631224 CTGGGTACATAACAAAATGAAGG - Intergenic
910398677 1:86816655-86816677 CTGGGTACATAACAAAATGAAGG + Intergenic
910658912 1:89649493-89649515 CTGGACACACAACAAAAAGAGGG - Intronic
910710032 1:90169730-90169752 CTGGGTACATAACAAAATGAAGG + Intergenic
910744058 1:90554003-90554025 CTGGGTACATAACAAAATGAAGG + Intergenic
910786176 1:91000439-91000461 TTGGGTACATAACGAAATGAAGG + Intronic
910949704 1:92632914-92632936 CTGGGTACATAACAAAATGAAGG - Intronic
910954335 1:92685305-92685327 CTGGGTACATAACAAAATGAAGG + Intronic
911170034 1:94761374-94761396 TTGGGTAAATAACAAAATGAAGG + Intergenic
911290793 1:96054819-96054841 CTGGGTACATAACAAAATGAAGG - Intergenic
911338303 1:96607136-96607158 CTGGATACATAACGAAATGAAGG + Intergenic
911427310 1:97734975-97734997 TTGGGTACACAAGAAAAAGAGGG + Intronic
911492896 1:98591413-98591435 CTGGGTACATAACAAAATGAAGG + Intergenic
911560761 1:99403063-99403085 CTGGGTACATAACAAAATGAAGG - Intergenic
911670407 1:100601479-100601501 CTGGGTACATAACAAAATGAAGG - Intergenic
911673685 1:100635481-100635503 CTGGGTACATAACAAAATGAAGG - Intergenic
911736977 1:101347923-101347945 TTGGGTAAACAATTAAATCAAGG - Intergenic
911750547 1:101492112-101492134 TTAGGTACACAATAAAATTAAGG - Intergenic
911851766 1:102829391-102829413 TTGGGTAAATAACAAAATGAAGG + Intergenic
911854165 1:102855695-102855717 TTCGATAAACAATAAAATTAAGG - Intergenic
911859645 1:102931333-102931355 CTGGGTACATAACAAAATGAAGG - Intronic
911954781 1:104220305-104220327 CTGGGTACACAACAAAATGAAGG - Intergenic
912081823 1:105946539-105946561 CTGGGTACATAACAAAATGAAGG - Intergenic
912110258 1:106332287-106332309 CTGGGTACATAACAAAATGAAGG + Intergenic
912743486 1:112224174-112224196 CTGGATACATAACGAAATGAAGG + Intergenic
913040429 1:115017293-115017315 CTGGGTACATAACAAAATGAAGG - Intergenic
913467136 1:119154515-119154537 CTGGGTACATAACAAAATGAAGG - Intergenic
913663384 1:121024834-121024856 TTGGGTAAACAATAAAATTAAGG + Intergenic
913694611 1:121312665-121312687 CTGGGTACATAACAAAATGAAGG - Intronic
913716036 1:121535474-121535496 CTGGGTACATAACAAAATGAAGG - Intergenic
913934216 1:125017942-125017964 CTGGGTACATAACAAAATGAAGG + Intergenic
913943018 1:125125823-125125845 CTGGGTACATAACAAAATGAAGG + Intergenic
914014775 1:143808098-143808120 TTGGGTAAACAATAAAATTAAGG + Intergenic
914163046 1:145153109-145153131 TTGGGTAAACAATAAAATTAAGG - Intergenic
914354258 1:146869254-146869276 CTGGATACATAACGAAATGAAGG + Intergenic
914653395 1:149716656-149716678 TTGGGTAAACAATAAAATTAAGG + Intergenic
914979774 1:152403431-152403453 CTGGGTACATAACAAAATGAAGG - Intergenic
915041893 1:152974812-152974834 TTGGATAGAAGTCAAAATCATGG + Intergenic
915084778 1:153378497-153378519 TTGGTTAAACAACAAAATTAAGG + Intergenic
915683827 1:157610284-157610306 CTGGGTACATAACAAAATGAAGG - Intergenic
915779415 1:158529749-158529771 TTGGATGGACAACGAAATTAAGG + Intergenic
915862106 1:159455714-159455736 CTGGATACATAACGAAATGAAGG + Intergenic
916333377 1:163643255-163643277 CTGGGTACATAACAAAATGAAGG - Intergenic
916373330 1:164124187-164124209 CTGGATACATAACAAAATGAAGG - Intergenic
916543589 1:165781281-165781303 CTGGGTACATAACAAAATGAAGG - Intronic
916905892 1:169282689-169282711 CTGGATAAATAACAAAATAAAGG - Intronic
916974288 1:170058920-170058942 CTGGGTACATAACAAAATGAAGG + Intronic
917093391 1:171376317-171376339 CTGGGTACATAACAAAATGAAGG + Intergenic
917192678 1:172434504-172434526 CTGGGTACATAACAAAATGAAGG + Intronic
917248592 1:173032411-173032433 CTGGATAAATAACAAAATTAAGG + Intergenic
917266901 1:173230330-173230352 CTGGGTACATAACAAAATGAAGG + Intergenic
917272302 1:173290980-173291002 TTGGATAAAGAACAAAATTAAGG + Intergenic
917397784 1:174613297-174613319 CTGGGTACATAACAAAATGAAGG - Intronic
917718528 1:177762281-177762303 CTGGGTACATAACAAAATGAAGG + Intergenic
917827658 1:178840402-178840424 CTGGGTACATAACAAAATGAAGG + Intronic
917900506 1:179538432-179538454 CTGGGTAAACAACAAAATGAGGG - Intronic
917914436 1:179687283-179687305 CTGGGTACATAACAAAATGAAGG - Intronic
917984592 1:180303006-180303028 TTGGGTACAAAACGAAATGAAGG + Intronic
917987574 1:180336413-180336435 TTGGGTACATAACGAAATGAAGG + Intronic
918020756 1:180686227-180686249 CTGGGTACATAACAAAATGAAGG - Intronic
918026878 1:180759017-180759039 CTGGGTACATAACAAAATGAAGG + Intronic
918089709 1:181278730-181278752 CTGGATACATAACGAAATGAAGG + Intergenic
918348142 1:183624700-183624722 TTGGGAGAACAACAAAATCAGGG - Intronic
918543025 1:185652244-185652266 TTGAATACTCAACAACATTATGG - Intergenic
918583538 1:186160661-186160683 CTGGGTACATAACGAAATCAAGG - Intronic
918614524 1:186529394-186529416 TTGGGTAAATAACAAAATTAAGG - Intergenic
918620008 1:186592450-186592472 TTGGATAAACAATGAAATTAAGG + Intergenic
918765533 1:188477960-188477982 TTGAATAAAGAACAAAATTAAGG - Intergenic
918826242 1:189328508-189328530 CTGGGTACATAACAAAATGAAGG - Intergenic
919128887 1:193429741-193429763 CTGGGTACATAACAAAATGAAGG - Intergenic
919175906 1:194018613-194018635 CTGGGTACATAACAAAATGAAGG - Intergenic
919182180 1:194100748-194100770 TTGGGTAAACAAGAAAATTAAGG - Intergenic
919260315 1:195184360-195184382 TTGGATAAACAATGAAATTAAGG + Intergenic
920359462 1:205403942-205403964 CTGGGTACATAACAAAATGAAGG - Intronic
920481939 1:206331048-206331070 CTGGGTACATAACAAAATGAAGG - Intronic
920781345 1:208994330-208994352 CTGGGTACATAACAAAATGAAGG + Intergenic
921992830 1:221386305-221386327 CTGGGTACATAACAAAATGAAGG - Intergenic
922172826 1:223170377-223170399 CTGGGTACACAACGAAATGAAGG + Intergenic
923345530 1:233048112-233048134 TTGGGTAAACAACAAAATTAAGG + Intronic
923835279 1:237604323-237604345 TGGGGTACATAACAAAATGAAGG + Intronic
923939504 1:238805338-238805360 TTGGTTATAGAACATAATCAAGG - Intergenic
924079574 1:240380386-240380408 TTGGGTAAACAACAAAATTAAGG + Intronic
924130117 1:240898523-240898545 CTGGGTACATAACAAAATGAAGG - Intronic
924298789 1:242615505-242615527 CTGGGTACATAACAAAATGAAGG + Intergenic
924392995 1:243583721-243583743 CTGGGTAAACAACAAAATCAAGG + Intronic
924452116 1:244187656-244187678 TGGGTTAAACAACAAATTCATGG + Intergenic
924489525 1:244522236-244522258 CTGGGTACATAACAAAATGAAGG + Intronic
924639422 1:245819295-245819317 CTGGATACATAACGAAATGAAGG + Intronic
924883956 1:248191860-248191882 TTGGGTAAATAACAAAATTAAGG + Intergenic
924889206 1:248255618-248255640 CTGGGTACATAACAAAATGAAGG + Intergenic
1062859544 10:799966-799988 TTGGGTAAACAACAAAATTAAGG + Intergenic
1063302482 10:4863361-4863383 CTGGGTACATAACAAAATGAAGG + Intergenic
1063324709 10:5086316-5086338 CTGGGTACATAACAAAATGAAGG - Intronic
1063528495 10:6807382-6807404 CTGGGTACATAACAAAATGAAGG - Intergenic
1063841011 10:10072616-10072638 CTGGGTACATAACAAAATGAAGG - Intergenic
1063897116 10:10694252-10694274 CTGGGTACACAACGAAATGAAGG - Intergenic
1064474066 10:15667759-15667781 CTGGGTACACAACGAAATGAAGG - Intronic
1064900880 10:20294650-20294672 CTGGATACATAACAAAATGAAGG - Intergenic
1064921931 10:20528927-20528949 CTGGGTACATAACAAAATGAAGG - Intergenic
1065107603 10:22406378-22406400 CTGGATACATAACGAAATGAAGG - Intronic
1065192502 10:23226340-23226362 CTGGGTACATAACAAAATGAAGG + Intronic
1065520782 10:26569222-26569244 TCTGATACCCAACTAAATCATGG + Intergenic
1065607312 10:27431261-27431283 CTGGGTACATAACAAAATGAAGG + Intergenic
1065735701 10:28750164-28750186 TTGGGTAAATAACAAAATTAAGG - Intergenic
1066077349 10:31893001-31893023 CTGGGTACATAACAAAATGAAGG + Intronic
1066163253 10:32757503-32757525 CTGGGTACATAACAAAATGAAGG + Intronic
1066176721 10:32915066-32915088 CTGGATACATAACAAAATGAAGG + Intronic
1066607957 10:37202388-37202410 CTGGGTACATAACGAAATCAAGG + Intronic
1066639464 10:37540838-37540860 CTGGGTACATAACAAAATGAAGG + Intergenic
1066648155 10:37631361-37631383 CTGGATACATAACAAAATGAAGG - Intergenic
1066655489 10:37695722-37695744 CTGGGTACATAACAAAATGAAGG + Intergenic
1066953414 10:42143245-42143267 CTGGGTACACAACAAAATGAAGG - Intergenic
1066992500 10:42529449-42529471 CTGGGTACATAACAAAATGAAGG - Intergenic
1067336053 10:45364915-45364937 CTGGGTACACAACGAAATGAAGG + Intergenic
1067896144 10:50181751-50181773 CTGGGTACATAACAAAATGAAGG + Intergenic
1067952834 10:50760250-50760272 CTGGGTACATAACAAAATGAAGG - Intronic
1067996474 10:51279195-51279217 TTGGGTACATAACAAAATGAAGG - Intronic
1068050558 10:51944695-51944717 CTGGATACAAAACGAAATGAAGG - Intronic
1068238213 10:54266212-54266234 TTGGGTAAACAAGAAAATTAAGG + Intronic
1068376617 10:56188999-56189021 CTGGGTACATAACAAAATGAAGG + Intergenic
1068394626 10:56445320-56445342 CTGGGTACATAACAAAATGAAGG - Intergenic
1068413445 10:56686703-56686725 CTGGGTACATAACAAAATGAAGG + Intergenic
1068423602 10:56826533-56826555 TTGGATAAACAACAAAATTAAGG + Intergenic
1068477708 10:57549515-57549537 CTGGGTACATAACAAAATGAGGG - Intergenic
1068552358 10:58421014-58421036 TTGGGTACATAACGAAATGAAGG - Intergenic
1068575988 10:58685110-58685132 CTGGGTACATAACAAAATGAAGG - Intronic
1068820665 10:61374552-61374574 TTGGATAAACAACAAAATTAAGG - Intergenic
1068940403 10:62675451-62675473 CTGGGTACATAACAAAATGAAGG - Intergenic
1069044421 10:63727203-63727225 TTGGGCAAACAACTAAATCAAGG + Intergenic
1069187623 10:65445345-65445367 TAAGATGCACAACATAATCAGGG + Intergenic
1069215912 10:65820762-65820784 ATGTATACAGAACATAATCAGGG - Intergenic
1069264929 10:66445574-66445596 CTGGGTACATAACAAAATGAAGG + Intronic
1069336837 10:67361524-67361546 TTGGGTAAACAGCAAAATCAAGG + Intronic
1069340832 10:67406333-67406355 TTGGATAAATAATAAAATTAAGG + Intronic
1069346788 10:67479503-67479525 TTGGGTAAACAACAAAATTAAGG + Intronic
1069353457 10:67556995-67557017 CTGGGTACATAACAAAATGAAGG - Intronic
1069356726 10:67595374-67595396 TTGGGTAAACAATAAAATTAAGG - Intronic
1069360736 10:67638760-67638782 CTGGGTACATAACAAAATGAAGG + Intronic
1070094782 10:73326237-73326259 TTGGGTACGTAACAAAATGAAGG + Intronic
1070347712 10:75561771-75561793 CTGGGTACATAACAAAATGAAGG - Intronic
1070411484 10:76145931-76145953 CTGGGTACATAACAAAATGAAGG - Intronic
1070709513 10:78669280-78669302 CTGGATAAATAACAAAATTAAGG + Intergenic
1070861760 10:79672795-79672817 TTGGAAAAACAAGAAAAACACGG + Intergenic
1070875391 10:79801834-79801856 TTGGAAAAACAAGAAAAACACGG - Intergenic
1071005957 10:80884347-80884369 CTGGGTACATAACAAAATGAAGG + Intergenic
1071066469 10:81642180-81642202 CTGGGTACATAACAAAATGAAGG - Intergenic
1071123332 10:82305818-82305840 TTGGATGTACAAAAAAATTAAGG - Intronic
1071362986 10:84869154-84869176 TTGGATAGACAACAAAATTAAGG + Intergenic
1071642319 10:87323976-87323998 TTGGAAAAACAAGAAAAACACGG - Intergenic
1071748282 10:88446215-88446237 CTGGCTACATAACAAAATGAAGG + Intronic
1071806908 10:89132356-89132378 TTAGATTCACAGCAAAATTAGGG - Intergenic
1071891456 10:90012333-90012355 CTGGATACATAACAAAATGAAGG + Intergenic
1071912670 10:90253375-90253397 CTGGGTACATAACAAAATGAAGG + Intergenic
1071990881 10:91099937-91099959 TTGAATGCTCAACAAAAGCAGGG + Intergenic
1072243917 10:93523840-93523862 CTGGGTACATAACAAAATGAAGG + Intronic
1072368698 10:94742122-94742144 TTGGGTAAACAATGAAATCAAGG - Intronic
1072855332 10:98939983-98940005 CTGGGTACACAACGAAATGAAGG + Intronic
1073022501 10:100457342-100457364 CTGGGTACATAACAAAATGAAGG + Intergenic
1073679244 10:105684272-105684294 TTATATAAACAACAAAATAAGGG - Intergenic
1073684629 10:105738609-105738631 CTGGGTACATAACAAAATGAAGG + Intergenic
1073837857 10:107464756-107464778 CTGGATACATAACGAAATGAAGG + Intergenic
1073975265 10:109093718-109093740 CTGGGTACATAACAAAATGAAGG - Intergenic
1074023332 10:109607705-109607727 CTGGGTACATAACAAAATGAAGG + Intergenic
1074030649 10:109684805-109684827 CTGGGTACATAACAAAATGAAGG - Intergenic
1074639589 10:115365761-115365783 CTGGATACATAACGAAATGAAGG - Intronic
1074664292 10:115701208-115701230 TTGGATAAACAACAAAATTAAGG + Intronic
1075205895 10:120447952-120447974 CTGGGTACATAACAAAATGAAGG + Intergenic
1076665801 10:132091019-132091041 CTGGGTACATAACAAAATCAAGG - Intergenic
1077710748 11:4534314-4534336 CTGGGTACACAACAAAATGAAGG + Intergenic
1077723139 11:4647225-4647247 TTATAAAAACAACAAAATCAGGG + Intronic
1077742036 11:4856973-4856995 CTGGGTACATAACAAAATGAAGG + Intronic
1077768126 11:5183471-5183493 CTGGGTACATAACAAAATGAAGG + Intronic
1077771012 11:5219224-5219246 CTGGGTACATAACAAAATGAAGG - Intergenic
1077794809 11:5480258-5480280 CTGGATACATAACGAAATGAAGG + Intronic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1077834868 11:5917230-5917252 CTGGGTACATAACAAAATGAAGG + Intronic
1077861814 11:6188112-6188134 CTGGATACATAACAAAATGAAGG + Intergenic
1077937887 11:6809505-6809527 TTGGGTAAACAACAAAACAAAGG - Intergenic
1078651500 11:13198655-13198677 TTGGGTAAACAATAAAATTAAGG + Intergenic
1078813804 11:14799172-14799194 CTGGGTACATAACAAAATGAAGG - Intronic
1079286476 11:19137812-19137834 TTGGGTACATAACAAAATGAAGG + Intronic
1079297695 11:19248071-19248093 TTGGGTAAACAACGAAATTATGG + Intergenic
1079461066 11:20678279-20678301 TTAGATCCTCACCAAAATCAAGG - Intronic
1079549072 11:21672288-21672310 CTGGGTACATAACAAAATCAAGG - Intergenic
1079598933 11:22287535-22287557 CTGGATACATAACGAAATGAAGG + Intergenic
1079660468 11:23031356-23031378 CTGGGTACATAACAAAATGAAGG - Intergenic
1079681292 11:23301406-23301428 CTGGGTACATAACAAAATGAAGG - Intergenic
1079692295 11:23434034-23434056 CTGGGTACATAACAAAATGAAGG + Intergenic
1079757133 11:24278908-24278930 TTGGGTAAACAACACAATTAAGG + Intergenic
1079827251 11:25212570-25212592 TGGGGTAGACAACAAAATTAAGG - Intergenic
1079863054 11:25698037-25698059 TTGAGTAAACAACAAAATTAAGG + Intergenic
1079934981 11:26606177-26606199 TTGGGTAAATAACAAAATTAAGG - Intronic
1079964867 11:26967880-26967902 CTGGGTACATAACAAAATGAAGG + Intergenic
1079988493 11:27222467-27222489 CTGGGTGCATAACAAAATCAAGG + Intergenic
1080090464 11:28342212-28342234 ATGGGTGCACAACTAAATCATGG - Intergenic
1080256775 11:30298790-30298812 TTGGGTAAACAACAAAATTAAGG + Intergenic
1080363763 11:31546886-31546908 CTGGGTACATAACAAAATGAAGG + Intronic
1080811195 11:35705663-35705685 CTGGGTACATAACAAAATGAAGG + Intronic
1080914419 11:36641514-36641536 CTGGCTACATAACAAAATGAAGG - Intronic
1081037518 11:38167235-38167257 CTGGGTACATAACAAAATGAAGG - Intergenic
1081125293 11:39313749-39313771 CTGGGTAAACAACAAAATTAAGG + Intergenic
1081161759 11:39757922-39757944 TTGGGTACGTAACAAAATGAAGG + Intergenic
1081165153 11:39799349-39799371 CTGGGTACATAACAAAATGAAGG + Intergenic
1081172288 11:39883786-39883808 CTGGATACATAACGAAATGAAGG + Intergenic
1081317462 11:41648304-41648326 CTGGATAAACAACAAAATTAAGG - Intergenic
1081325685 11:41741656-41741678 CTGGGTACATAACAAAATGAAGG + Intergenic
1081697476 11:45125580-45125602 CTGGGTACATAACAAAATGAAGG - Intronic
1082010244 11:47445294-47445316 TGGGATACATTACAAAAACAAGG + Intronic
1082102926 11:48188987-48189009 CTGGGTACATAACAAAATGAAGG - Intergenic
1082107239 11:48233912-48233934 CTGGGTACATAACAAAATGAAGG - Intergenic
1082134391 11:48531149-48531171 CTGGGTACATAACGAAATCAAGG - Intergenic
1082135546 11:48545145-48545167 CTGGATACATAACGAAATGAAGG - Intergenic
1082136666 11:48556815-48556837 CTGGATACATAACGAAATGAAGG - Intergenic
1082150845 11:48736782-48736804 TGGGGTACACAACGAAATGAAGG + Intergenic
1082196325 11:49310986-49311008 CTGGGTACATAACAAAATGAAGG - Intergenic
1082233416 11:49796399-49796421 CTGGGTACACAACGAAATGAAGG - Intergenic
1082279494 11:50256404-50256426 CTGGGTACATAACAAAATGAAGG - Intergenic
1082298410 11:50473646-50473668 CTGGGTACATAACAAAATGAAGG - Intergenic
1082556047 11:54564460-54564482 CTGGGTACATAACAAAATGAAGG - Intergenic
1082567419 11:54697547-54697569 CTGGGTACATAACAAAATGAAGG - Intergenic
1082586715 11:54949730-54949752 CTGGATACATAACGAAATGAAGG + Intergenic
1082599424 11:55130743-55130765 CTGGGTACATAACAAAATGAAGG + Intergenic
1082602082 11:55170769-55170791 CTGGGTACACAACGAAATGAAGG - Intergenic
1082662630 11:55931577-55931599 TTGGGTAAACAAAAAAATTAAGG - Intergenic
1082743965 11:56942299-56942321 CTGGGTACATAACAAAATCAAGG - Intergenic
1082905796 11:58307372-58307394 CTGGGTACATAACAAAATGAAGG - Intergenic
1082941070 11:58706154-58706176 TTGGATAAACAATAAAATTAAGG + Intronic
1082949710 11:58799569-58799591 TTGGGTAAACAACAAAACTAAGG + Intergenic
1082956371 11:58874529-58874551 CTGGGTACACAACGAAATGAAGG - Intronic
1082970759 11:59018129-59018151 CTGGGTACATAACAAAATGAAGG + Intronic
1083006022 11:59347411-59347433 CTGGGTACATAACAAAATGAAGG - Intergenic
1083165522 11:60883651-60883673 CTGGGTACATAACAAAATGAAGG + Intergenic
1083510499 11:63205062-63205084 TTGGGTAAATAACAAAATTAAGG + Intronic
1083524293 11:63347650-63347672 CTGGGTACATAACAAAATGAAGG - Intronic
1083525951 11:63365304-63365326 CTGGGTACATAACAAAATGAAGG - Intronic
1083973020 11:66093947-66093969 CTGGGTACATAACAAAATGAAGG + Intronic
1084797041 11:71513934-71513956 CTGGGTACATAACAAAATGAAGG + Intronic
1085221797 11:74880702-74880724 CTGGGTACACAACGAAATGAAGG - Intronic
1085222874 11:74890302-74890324 CTGGGTACACAACGAAATGAAGG + Intronic
1085876252 11:80409303-80409325 TTGGGCAAACAACAAAATTAAGG + Intergenic
1086086950 11:82965452-82965474 TTGGGTAAATAACAAAATTAAGG - Intronic
1086130463 11:83396140-83396162 CTGGATACATAACAAAATGAAGG + Intergenic
1086149274 11:83590391-83590413 CTGGATACATAACGAAATGAAGG + Intronic
1086152061 11:83622644-83622666 TTGGGTAAACAGCAAAATTAAGG - Intronic
1086417251 11:86600853-86600875 CTGGGTACACAACGAAATGAAGG + Intronic
1086422756 11:86653496-86653518 CTGGGTACATAACAAAATGAAGG + Intronic
1086523771 11:87701335-87701357 CTGGGTACATAACAAAATGAAGG - Intergenic
1086560114 11:88157740-88157762 TCGGATAAACAATAAAATAAAGG + Intronic
1086661881 11:89429110-89429132 CTGGGTACATAACAAAATGAAGG + Intronic
1086799057 11:91148746-91148768 TTAGAAACACAAAAAAATAAAGG - Intergenic
1086870352 11:92029642-92029664 TTGGGTACATAACGAAATGAAGG + Intergenic
1086883114 11:92172313-92172335 CTGGGTACATAACAAAATGAAGG + Intergenic
1086967602 11:93045788-93045810 CTGGGTACATAACAAAATGAAGG + Intergenic
1087072675 11:94097257-94097279 CTGGGTACATAACAAAATGAAGG - Intronic
1087087598 11:94235762-94235784 CTGGATACATAACGAAATGAAGG - Intergenic
1087248876 11:95873835-95873857 TTGGGTACATAACAAAATGAAGG - Intronic
1087298767 11:96408867-96408889 TTGGGTACATAACAAAATGAAGG - Intronic
1087312277 11:96558477-96558499 TTGGGTACATAACGAAATGAAGG + Intergenic
1087330510 11:96775035-96775057 CTGGATACATAACGAAATGAAGG - Intergenic
1087341286 11:96910818-96910840 CTGGATACACAATGAAATGAAGG + Intergenic
1087372244 11:97300040-97300062 CTGGGTACATAACAAAATGAAGG + Intergenic
1087476940 11:98648313-98648335 CTGGGTACATAACAAAATGAAGG - Intergenic
1087586272 11:100126041-100126063 TTGGGTAAACAACAAAATTAAGG - Intronic
1087604697 11:100363452-100363474 TTGGGTAAACAACAACATTAAGG - Intergenic
1087669236 11:101085338-101085360 TTGAGTAAACAATAAAATCAAGG + Intronic
1087780792 11:102299856-102299878 CTGGGTACATAACAAAATGAAGG - Intergenic
1087794536 11:102441444-102441466 CTGGGTACATAACAAAATGAAGG + Intronic
1088309359 11:108443720-108443742 CTGGGTACATAACAAAATGAAGG + Intronic
1088309777 11:108447535-108447557 CTGGGTACATAACAAAATGAAGG + Intronic
1088398981 11:109402055-109402077 CTGGGTACATAACAAAATGAAGG + Intergenic
1088516662 11:110643506-110643528 TTGGTTAAACAACGAAATTAAGG - Intronic
1088691091 11:112328847-112328869 CTGGATAAATAACAAAATGAAGG - Intergenic
1088943804 11:114488609-114488631 CTGGATACATAACGAAATGAAGG + Intergenic
1089009883 11:115123601-115123623 TTGGATACTCAAAGCAATCAAGG + Intergenic
1090318665 11:125820831-125820853 CTGGATAAATAACAAAATTAAGG + Intergenic
1090361534 11:126175940-126175962 TTGCATAGGCAACAAAACCAAGG - Intergenic
1090555637 11:127871921-127871943 CTGGGTACATAACAAAATGAAGG - Intergenic
1090706470 11:129342160-129342182 CTGGATACATAACGAAATGAAGG - Intergenic
1091246874 11:134104258-134104280 CTGGGTACATAACAAAATGAAGG + Intronic
1091299149 11:134495508-134495530 CTGGGTACATAACAAAATGAAGG - Intergenic
1091708284 12:2715790-2715812 TTGAATAAATAACAAAATTAAGG + Intergenic
1091943444 12:4511640-4511662 CTGGGTACATAACAAAATGAAGG + Intronic
1092011764 12:5119655-5119677 CTGGGTACATAACAAAATGAAGG - Intergenic
1092304638 12:7286472-7286494 CTGGGTAAACAACAAAATTAAGG + Intergenic
1092328689 12:7562155-7562177 CTGGGTACATAACAAAATGAAGG + Intergenic
1092393930 12:8108124-8108146 TTGGGTAAACAATAAAATTAAGG - Intergenic
1092398643 12:8151991-8152013 CTGGATAAACAACAAAATGAAGG - Intronic
1092561016 12:9613202-9613224 CTGGGTACACAACGAAATGAAGG + Intergenic
1092562415 12:9630509-9630531 CTGGGTACACAACGAAATGAAGG - Intergenic
1092715020 12:11380053-11380075 CTGGGTACACAACAAAATGAAGG + Intronic
1093134612 12:15436027-15436049 CTGGATACATAACGAAATGAAGG + Intronic
1093135219 12:15441256-15441278 TTGGGTAAACAATGAAATCAAGG + Intronic
1093275418 12:17119247-17119269 CTGGGTACATAACAAAATGAAGG + Intergenic
1093309540 12:17562338-17562360 CTGGGTACACAACGAAATGAAGG - Intergenic
1093344101 12:18018968-18018990 TTGGGTAAACAATAAAATTAAGG + Intergenic
1093477333 12:19570683-19570705 TTGGATAAACAATGAAATTAAGG - Intronic
1093655606 12:21690658-21690680 TTGGATAAACAATGAAATTAAGG + Intronic
1093862804 12:24188324-24188346 TTGGATAAACAACAATACTAGGG - Intergenic
1094084809 12:26577691-26577713 TTGTATTCAAATCAAAATCAGGG + Intronic
1094114923 12:26900714-26900736 CTGGGTACATAACAAAATTAAGG + Intergenic
1094296978 12:28917835-28917857 TTGGGTAAACAACGAAATTAAGG + Intergenic
1094791610 12:33921389-33921411 TTGGGTAAATAACAAAATTAAGG - Intergenic
1094861084 12:34467292-34467314 CTGGGTACATAACAAAATGAAGG - Intergenic
1095059310 12:37663829-37663851 CTGGATACATAACGAAATGAAGG - Intergenic
1095089902 12:38094216-38094238 CTGGGTGCATAACAAAATCAAGG + Intergenic
1095151631 12:38802409-38802431 CTGGGTACATAACAAAATGAAGG + Intronic
1095217483 12:39566871-39566893 CTGGGTACATAACAAAATGAAGG - Intronic
1095275815 12:40281356-40281378 TTGGCTACACAGCAGATTCATGG + Intronic
1095340601 12:41084695-41084717 CTGGGTACATAACAAAATGAAGG - Intergenic
1095346969 12:41161447-41161469 CTGGGTACATAACAAAATGAAGG + Intergenic
1095373738 12:41501453-41501475 TTGGATATACTGCAAAATCTGGG - Intronic
1095385037 12:41640658-41640680 CTGGATACATAACGAAATGAAGG - Intergenic
1095388264 12:41675209-41675231 CTGGATACATAACGAAATGAAGG + Intergenic
1095834308 12:46620381-46620403 CTGGGTACATAACAAAATGAAGG + Intergenic
1095845873 12:46743808-46743830 TTGGATAAACAATGAAATTAAGG + Intergenic
1095932307 12:47639563-47639585 TTGGGTCAAAAACAAAATCAAGG + Intergenic
1096032934 12:48436656-48436678 TGGGGTACATAACGAAATCAAGG + Intergenic
1096236431 12:49930733-49930755 TTGGATACAGAACTAAACCATGG + Intergenic
1096723602 12:53543225-53543247 TTGGTTAAAACACAAAATCATGG - Intronic
1096952374 12:55486774-55486796 CTGGGTACATAACAAAATGAAGG + Intergenic
1096954091 12:55507935-55507957 CTGGATACATAACGAAATGAAGG - Intergenic
1097150111 12:56971192-56971214 CTGGCTACATAACAAAATAAAGG + Intergenic
1097310357 12:58112523-58112545 CTGGGTACATAACAAAATGAAGG - Intergenic
1097344344 12:58474647-58474669 CTGGATACATAACGAAATGAAGG - Intergenic
1097365462 12:58707565-58707587 CTGGGTACATAACAAAATGAAGG - Intronic
1097430441 12:59498975-59498997 CTGGGTACATAACAAAATGAAGG - Intergenic
1097546204 12:61004327-61004349 CTGGGTACATAACAAAATGAAGG - Intergenic
1097916830 12:65030085-65030107 TTGGGTAAACAACAAAATAAAGG - Intergenic
1097944462 12:65351213-65351235 CTGGATACATAACGAAATGAAGG + Intronic
1097963153 12:65552655-65552677 CTGGATACATAACGAAATGAAGG - Intergenic
1098181013 12:67847047-67847069 CTGGGTACATAACAAAATGAAGG - Intergenic
1098186600 12:67902967-67902989 CTGGATACATAACAAAATGAAGG + Intergenic
1098375374 12:69808131-69808153 CTGGGTACATAACAAAATGAAGG - Intronic
1098492660 12:71100373-71100395 CTGGATACATAACGAAATGAAGG + Intronic
1098494733 12:71120837-71120859 CTGGATACATAACGAAATGAAGG + Intergenic
1098675631 12:73286897-73286919 CTGGATACATAACGAAATGAAGG - Intergenic
1098677780 12:73313068-73313090 TTGGGTAAACAACAAAATTAAGG - Intergenic
1098684146 12:73397569-73397591 CTGGATACATAACGAAATGAAGG + Intergenic
1099041249 12:77656859-77656881 CTGGGTACATAACAAAATGAAGG + Intergenic
1099145861 12:79042866-79042888 CTGGGTACATAACAAAATGAAGG - Intronic
1099409289 12:82304816-82304838 CTGGATACATAACGAAATGAAGG - Intronic
1099434985 12:82632434-82632456 CTGGGTACATAACAAAATGAAGG - Intergenic
1099549154 12:84021550-84021572 CTGGGTACATAACAAAATGAAGG + Intergenic
1099627703 12:85096401-85096423 TTGGTTAAACAACAAAATTAAGG - Intronic
1099634301 12:85194574-85194596 CTGGGTACATAACAAAATGAAGG + Intronic
1099678127 12:85788297-85788319 CTGGGTACATAACAAAATGAAGG + Intergenic
1099750527 12:86766769-86766791 CTGGGTACATAACAAAATGAAGG + Intronic
1099765152 12:86973288-86973310 CTGGGTACACAACAAAATGAAGG + Intergenic
1099767397 12:87005492-87005514 CTGGGTAAACAACAAAATTAAGG - Intergenic
1099795714 12:87396807-87396829 CTGGATACATAACGAAATGAAGG + Intergenic
1099807134 12:87533821-87533843 CTGGATACATAACGAAATGAAGG + Intergenic
1099841506 12:87973004-87973026 CTGGGTACATAACAAAATGAAGG - Intergenic
1100058255 12:90539369-90539391 CTGGGTACATAACAAAATGAAGG + Intergenic
1100477927 12:94951244-94951266 ATGACTACACAACAAAAACAAGG - Intronic
1100965996 12:100013586-100013608 TTGGGTACATAACAAAATGAAGG + Intergenic
1101028799 12:100640063-100640085 CTGGGTACATAACAAAATGAAGG - Intergenic
1101077797 12:101148802-101148824 CTGGATACATAACGAAATGAAGG + Intergenic
1101657274 12:106733823-106733845 TTGGATACACACCCAAAAGAAGG + Intronic
1101702506 12:107187957-107187979 CTGGGTACATAACAAAATGAAGG + Intergenic
1101929308 12:108999713-108999735 CTGGATACATAACGAAATGAAGG + Intronic
1102366816 12:112344616-112344638 TTGGATTAAGAAAAAAATCAGGG + Intronic
1102418083 12:112781760-112781782 TTAGATACACAAGAAAGACATGG + Intronic
1102473195 12:113171755-113171777 ATGGACACACACCAAAATGACGG + Intronic
1105802317 13:23917902-23917924 TTGGGTAAACAACAAAATTAAGG + Intergenic
1105992877 13:25640004-25640026 CTGGGTACATAACAAAATGAAGG + Intronic
1106443750 13:29804220-29804242 TTGGGTAAACAATAAAATTAAGG + Intronic
1106990811 13:35417476-35417498 CTGGGTACATAACAAAATGAAGG - Intronic
1106991418 13:35425387-35425409 CTGGGTACATAACAAAATGAAGG - Intronic
1107090240 13:36471539-36471561 CTGGGTACATAACAAAATGAAGG - Intergenic
1107154715 13:37153197-37153219 CTGGATACATAACGAAATGAAGG - Intergenic
1107207783 13:37816007-37816029 TTGGATAAACAGTAAAATTAAGG + Intronic
1107208572 13:37825513-37825535 CTGGGTACATAACAAAATGAAGG - Intronic
1107310901 13:39076329-39076351 TTAGGTACACAACAAAATAAAGG + Intergenic
1107370611 13:39743005-39743027 CTGGGTACATAACGAAATCAAGG + Intronic
1107380445 13:39851511-39851533 CTGGGTACATAACAAAATGAAGG - Intergenic
1107492052 13:40889854-40889876 TTGGGTACATAACGAAATAAAGG + Intergenic
1107641607 13:42449239-42449261 TTGAATAAACAAGAAAATTAGGG + Intergenic
1108265164 13:48699420-48699442 CTGGGTACATAACAAAATGAAGG + Intronic
1108414450 13:50183541-50183563 CTGGATACATAACAAAATGAAGG - Intronic
1108547728 13:51512942-51512964 CTGGATACATAACAAAATTAAGG - Intergenic
1108561814 13:51651656-51651678 CTGGGTACATAACAAAATCAAGG - Intronic
1108962323 13:56249228-56249250 TTGGATACACAATTAAATAAAGG - Intergenic
1108997488 13:56752717-56752739 TCAGAAACACAACAAAATCTAGG - Intergenic
1109047364 13:57430029-57430051 TGGGGTAAACAACAAAATCAAGG + Intergenic
1109120944 13:58456251-58456273 TTGGGTAAACAACAAAATAAAGG + Intergenic
1109196196 13:59380007-59380029 TTGGGTAAATAACAAAATTAAGG + Intergenic
1109270354 13:60249138-60249160 CTGGGTACATAACAAAATGAAGG - Intergenic
1109484818 13:63004764-63004786 TTGGGTGAACAATAAAATCAAGG + Intergenic
1109806907 13:67455205-67455227 TTGGATAAATAACAAAATGAAGG + Intergenic
1109974276 13:69810440-69810462 TTGGTTAAAAAACAAAATTAGGG + Intronic
1110258261 13:73456219-73456241 CTGGGTACATAACAAAATAAAGG - Intergenic
1110276103 13:73643283-73643305 CTGGGTACATAACGAAATCAAGG + Intergenic
1110415175 13:75244392-75244414 TTGGGTACCTAACAAAATGAAGG - Intergenic
1110532748 13:76616069-76616091 CTGGATACATAACGAAATGAAGG - Intergenic
1110638564 13:77794229-77794251 TTGGGTAAACAACAAATTAAGGG + Intergenic
1110916190 13:81023971-81023993 TTGGGTAAACAACAAAATTAAGG + Intergenic
1111004640 13:82231898-82231920 CTGGGTACATAACAAAATGAAGG + Intergenic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1111239251 13:85453244-85453266 TTGGATAAACAACTAATTCCAGG - Intergenic
1111317221 13:86578375-86578397 TTGGATAATTAACAAAAACAAGG - Intergenic
1111498944 13:89090649-89090671 CTGGATACATAACGAAATGAAGG + Intergenic
1111747049 13:92283643-92283665 CTGGGTACATAACAAAATGAAGG + Intronic
1111814332 13:93131892-93131914 TTGGATAAATAACAAAATTAAGG - Intergenic
1111970654 13:94911589-94911611 TTGGATGAACAATAAAATTAAGG - Intergenic
1112087632 13:96048235-96048257 CTGGGTACATAACAAAATGAAGG + Intronic
1112351582 13:98639411-98639433 TAGAATACACAAAAAAATTATGG + Intergenic
1112981079 13:105385086-105385108 CTGGGTACATAACAAAATGAAGG + Intergenic
1113121872 13:106932577-106932599 CTGGATACATAACGAAATGAAGG - Intergenic
1113273700 13:108704543-108704565 TTAGATTCACAGCAAAATTAAGG + Intronic
1113383510 13:109826312-109826334 CTGGGTACATAACAAAATGAAGG - Intergenic
1113544379 13:111136495-111136517 CTGGGTACATAACAAAATGAAGG + Intronic
1113703442 13:112407118-112407140 CTGGGTACATAACAAAATGAAGG + Intronic
1114609365 14:24027468-24027490 CTGGGTACATAACAAAATGAAGG + Intergenic
1114681651 14:24489697-24489719 CTGGGTACATAACAAAATGAAGG + Intergenic
1114685676 14:24528826-24528848 CTGGGTACATAACAAAATGAAGG + Intergenic
1114817942 14:25982073-25982095 CTGGATAAATAACAAAATTAAGG + Intergenic
1114872944 14:26679474-26679496 TTGGCTACATAACAAATTCTAGG + Intergenic
1114899845 14:27044247-27044269 CTGGGTACATAACAAAATGAAGG - Intergenic
1114907383 14:27147488-27147510 TTGGGAAAACAACAAAATTAAGG - Intergenic
1114983201 14:28191205-28191227 CTGGATACATAACGAAATGAAGG + Intergenic
1115083139 14:29481389-29481411 CTGGGTACATAACAAAATGAAGG - Intergenic
1115156472 14:30345404-30345426 TTGGGTAAACAACAAAATTAAGG - Intergenic
1115409777 14:33060981-33061003 TTGGATTCACAACCAAAAGAGGG + Intronic
1115438133 14:33400616-33400638 TTAGATAAACAACATAACCAGGG + Intronic
1115477334 14:33828370-33828392 CTGGCTACATAACAAAATGAAGG + Intergenic
1115719582 14:36145902-36145924 CTGGGTACATAACAAAATGAAGG - Intergenic
1115743745 14:36414595-36414617 CTGGTTACACAACAAAATAAAGG + Intergenic
1115849264 14:37575914-37575936 TTGGAGAAAGAACAAAAGCATGG + Intergenic
1116061067 14:39924751-39924773 CTGGGTACATAACAAAATGAAGG - Intergenic
1116119846 14:40708508-40708530 TTGGGTAAGCAATAAAATCAAGG + Intergenic
1116236227 14:42282859-42282881 CTGGGTACATAACGAAATCAAGG - Intergenic
1116292858 14:43065100-43065122 CTGGATACATAACGAAATGAAGG + Intergenic
1116339324 14:43701405-43701427 CTGGGTACATAACGAAATCAAGG + Intergenic
1116545801 14:46164376-46164398 CTGGGTACATAACAAAATGAAGG - Intergenic
1116714955 14:48415379-48415401 CTGGGTACATAACAAAATGAAGG - Intergenic
1116766724 14:49081177-49081199 TTGGGTAAACAACAAAAATAAGG - Intergenic
1116768423 14:49099469-49099491 CTGGATACATAACGAAATGAAGG + Intergenic
1117104813 14:52387057-52387079 CTGGGTACATAACAAAATGAAGG + Intergenic
1117188705 14:53269650-53269672 CTGGATACATAACGAAATGAAGG - Intergenic
1117529199 14:56642409-56642431 CTGGGTACATAACAAAATGAAGG + Intronic
1117648846 14:57881358-57881380 TTTGTTTCACAACAAAATCCTGG - Intronic
1117663811 14:58035300-58035322 CTGGGTACATAACAAAATGAAGG + Intronic
1117824860 14:59690841-59690863 TTGGGTAAAGAACAAAATTAAGG + Intronic
1117889937 14:60409309-60409331 TTGGATAAATAACAAAATCAAGG - Intronic
1117892908 14:60445963-60445985 CTGGATAAATAACAAAATGAAGG + Intronic
1117900372 14:60526491-60526513 CTGGGTACATAACAAAATGAAGG - Intergenic
1117938904 14:60939472-60939494 CTGGGTACATAACGAAATCAAGG - Intronic
1118096088 14:62538592-62538614 CTGGGTACATAACAAAATGAAGG + Intergenic
1118104222 14:62639446-62639468 CTGGGTACATAACAAAATGAAGG + Intergenic
1118446682 14:65858100-65858122 CTGGGTACATAACAAAATGAAGG - Intergenic
1118525518 14:66636460-66636482 TTGGAGACACAGCCAAATAAAGG - Intronic
1118558519 14:67052847-67052869 CTGGATAAATAACGAAATCAAGG + Intronic
1119156096 14:72412808-72412830 CTGGGTACATAACAAAATGAAGG - Intronic
1119699901 14:76747176-76747198 CTGGATACATAACAAAAAGAAGG + Intergenic
1120274108 14:82350303-82350325 CTGGGTACATAACAAAATGAAGG + Intergenic
1120279167 14:82417598-82417620 TTGGGTAAACAATAAAATTAAGG - Intergenic
1120371564 14:83642070-83642092 CTGGGTACATAACGAAATCAAGG + Intergenic
1120470673 14:84919574-84919596 TAGGATAAACAACAAAACCTTGG - Intergenic
1120507436 14:85370169-85370191 TTGGGTAAATAACAAAATTAAGG - Intergenic
1120553832 14:85905155-85905177 CTGGATAAATAACAAAATTAAGG - Intergenic
1120567450 14:86077735-86077757 CTGGGTACATAACAAAATGAAGG - Intergenic
1120638143 14:86976848-86976870 TTGGGTAAATAACAAAATTAAGG + Intergenic
1120742666 14:88125443-88125465 CTGGGTACATAACAAAATTAAGG - Intergenic
1121129606 14:91434107-91434129 CTGGATACATAACGAAATGAAGG - Intergenic
1121151911 14:91643450-91643472 CTGGATACATAACGAAATGAAGG - Intronic
1123225148 15:17016481-17016503 CTGGGTACATAACAAAATGAAGG + Intergenic
1123408005 15:20035173-20035195 CTGGGTACACAACGAAATGAAGG - Intergenic
1123517328 15:21041827-21041849 CTGGGTACACAACGAAATGAAGG - Intergenic
1123609413 15:22074167-22074189 TTGGGTACATAACGAAATGAAGG - Intergenic
1123780782 15:23625861-23625883 TTGGGTAAACAATAAAATTATGG - Intronic
1123832525 15:24155526-24155548 CTGGGTACATAACAAAATGAAGG - Intergenic
1123877354 15:24637174-24637196 CTGGGTACATAACAAAATGATGG - Intergenic
1124402303 15:29359851-29359873 TTAAATACACATGAAAATCAGGG + Intronic
1124574975 15:30899858-30899880 TGGGGTACAAAACCAAATCAAGG - Intergenic
1124838588 15:33220164-33220186 TTGGGTAAACAAAAAAATTAAGG + Intergenic
1125124000 15:36198135-36198157 CTGGATACATAACGAAATGAAGG + Intergenic
1125224709 15:37382346-37382368 CTGGGTACATAACAAAATGAAGG + Intergenic
1125290375 15:38139938-38139960 CTGGGTACATAACAAAATGAAGG - Intergenic
1125331174 15:38583607-38583629 CTGGGTACATAACAAAATGAAGG + Intergenic
1125358141 15:38838178-38838200 CTGGATACATAAAAAAATGAAGG - Intergenic
1125393392 15:39221158-39221180 CTGGGTACATAACAAAATGAAGG + Intergenic
1126265024 15:46743908-46743930 CTGGGTAAATAACAAAATCAAGG + Intergenic
1126403911 15:48303121-48303143 GTTGATAAACAAGAAAATCAAGG + Exonic
1126746561 15:51831236-51831258 TTGGATATACCACAAAATTTAGG - Intronic
1127021362 15:54752154-54752176 CTGGGTACATAACAAAATGAAGG + Intergenic
1127030298 15:54853954-54853976 CTGGGTACACAACAAAATTAAGG + Intergenic
1127049575 15:55066757-55066779 CTGGATACATAACGAAATGAAGG + Intergenic
1127097212 15:55524557-55524579 TTGGGTAAACAATAAAATTAAGG - Intergenic
1127190152 15:56521157-56521179 TTGGGTAAACAACAACATTAAGG + Intergenic
1127270700 15:57398870-57398892 ATGGTTAAACAACAAAAACATGG - Intronic
1127319868 15:57832925-57832947 TTGGGTAAACAATAAAATTAAGG + Intergenic
1127491500 15:59468950-59468972 CTGGGTACATAACAAAATGAAGG - Intronic
1128677260 15:69620265-69620287 CTGGGTACATAACAAAATGAAGG - Intergenic
1129132341 15:73511684-73511706 CTGGATACATAACGAAATGAAGG - Intronic
1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG + Intergenic
1129563500 15:76595715-76595737 CTGGTTACATAACAAAATTAAGG + Intronic
1129563831 15:76599492-76599514 TGGAATACACAAACAAATCAAGG + Intronic
1129631940 15:77269911-77269933 CTGGGTACATAACAAAATGAAGG - Intronic
1129636297 15:77322030-77322052 CTGGATACATAACGAAATGAAGG + Intronic
1129796256 15:78379189-78379211 CTGGGTACATAACAAAATGAAGG - Intergenic
1129916038 15:79272929-79272951 CTGGGTACATAACAAAATGAAGG + Intergenic
1130198191 15:81800697-81800719 CTGGATACATAACAAAATGAAGG + Intergenic
1130205733 15:81873433-81873455 CTGGATACATAACGAAATGAAGG + Intergenic
1130218646 15:81997932-81997954 CTGGATACATAACGAAATGAAGG + Intergenic
1130382892 15:83386414-83386436 CTGGATACATAACGAAATGAAGG + Intergenic
1130572017 15:85055052-85055074 CTGGATACATAACGAAATGAAGG - Intronic
1130787630 15:87117743-87117765 TTGGACATCCAACAAACTCATGG - Intergenic
1130811180 15:87380109-87380131 CTGGGTACACAACGAAATGAAGG + Intergenic
1130822791 15:87512654-87512676 CTGGGTACATAACAAAATGAAGG + Intergenic
1130947198 15:88557481-88557503 CTGGGTACATAACAAAATGAAGG - Intergenic
1131081020 15:89535607-89535629 CTGGGTACATAACAAAATGAAGG - Intergenic
1131299065 15:91179133-91179155 CTGGGTACATAACAAAATGAAGG - Intronic
1131402854 15:92140218-92140240 CTGGATACATAACGAAATGAAGG - Intronic
1131489897 15:92853525-92853547 GTTGATTCAAAACAAAATCAGGG - Intergenic
1131584468 15:93678165-93678187 CTGGGTACATAACAAAATGAAGG + Intergenic
1131634098 15:94211519-94211541 CTGGGTACATAACAAAATGAAGG - Intergenic
1131928815 15:97416550-97416572 TTGGGTACATAACGAAATGAAGG - Intergenic
1131988935 15:98073758-98073780 CTGGGTAAACAACAAAATTAAGG - Intergenic
1132084488 15:98896105-98896127 CTGCATACACAATAAAAGCAAGG - Intronic
1132218569 15:100086742-100086764 CTGGGTACATAACAAAATGAAGG + Intronic
1133857355 16:9562072-9562094 TTGGAGACAGAACAAAGACAGGG + Intergenic
1133956660 16:10450059-10450081 ATGGATAAATAACAAAATTAAGG - Intronic
1134764840 16:16748282-16748304 CTGGGTACATAACAAAATGAAGG - Intergenic
1134981207 16:18610931-18610953 CTGGGTACATAACAAAATGAAGG + Intergenic
1135301509 16:21332263-21332285 CTGGGTACATAACAAAATGAAGG - Intergenic
1135738664 16:24954752-24954774 TTAGACACCCAACAAACTCACGG + Intronic
1136600290 16:31281959-31281981 CTGGATACATAACAAAATGAAGG - Intronic
1136602945 16:31308892-31308914 CTGGGTACATAACAAAATGAAGG - Intronic
1136606851 16:31340772-31340794 CTGGGTACATAACAAAATGAAGG + Intergenic
1136647326 16:31633107-31633129 CTGGATACATAACGAAATGAAGG - Intergenic
1136770882 16:32839922-32839944 CTGGGTACATAACAAAATAAAGG - Intergenic
1136917111 16:34216077-34216099 CTGGGTACATAACAAAATGAAGG - Intergenic
1136986990 16:35116178-35116200 CTGGGTACATAACAAAATAAAGG + Intergenic
1137000796 16:35228988-35229010 CTGGGTACATAACAAAATGAAGG - Intergenic
1137075538 16:35956598-35956620 ATGGGTACATAACAAAATGAAGG - Intergenic
1137907322 16:52336292-52336314 CTGGGTACATAACAAAATGAAGG + Intergenic
1138357417 16:56394110-56394132 CTGGGTACATAACAAAATGAAGG + Intronic
1138579333 16:57930070-57930092 TTGGATAAACAACCAGAACAGGG - Intronic
1138809846 16:60136817-60136839 TTGGGTACAAAATAAAATTAAGG - Intergenic
1138842436 16:60525524-60525546 CTGGATACATAACGAAATGAAGG + Intergenic
1138972782 16:62166780-62166802 TTGGGTAAACAACAAAATTAAGG - Intergenic
1139053144 16:63150032-63150054 CTGGGTACATAACAAAATGAAGG + Intergenic
1139257226 16:65554014-65554036 CTGGGTACATAACGAAATCAAGG + Intergenic
1139272041 16:65692755-65692777 CTGGGTACATAACGAAATCAAGG + Intergenic
1139376225 16:66498849-66498871 CTGGGTACACAACGAAATGAAGG + Intronic
1139979760 16:70846282-70846304 CTGGATACATAACGAAATGAAGG - Intronic
1140169033 16:72583679-72583701 TTGGGTACATAACGAAATGAAGG + Intergenic
1140178985 16:72695262-72695284 CTGGGTACATAACAAAATGAAGG - Intergenic
1140538981 16:75738074-75738096 TTGGGTACGTAACAAAATAAAGG - Intronic
1140979084 16:80089309-80089331 CTGGATACATAACGAAATGAAGG - Intergenic
1141210622 16:81976428-81976450 TTGAATAAACAACAAAATTAAGG + Intergenic
1141228512 16:82142000-82142022 CTGGATACCTAACAAAATGAAGG + Intergenic
1141234901 16:82207006-82207028 CTGGGTACATAACAAAATGAAGG - Intergenic
1142917113 17:3150615-3150637 CTGGGTACATAACAAAATGAAGG - Intergenic
1142935769 17:3329952-3329974 CTGGATACATAACGAAATGAAGG - Intergenic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1144399455 17:14882161-14882183 TTGGGTAAACAACAAAATTAAGG - Intergenic
1144406785 17:14959610-14959632 CTGGCTACACATTAAAATCATGG - Intergenic
1147200363 17:38797724-38797746 CAGGATGCAGAACAAAATCAAGG + Intronic
1147524074 17:41204114-41204136 CTGGATACATAACGAAATGAAGG - Intronic
1147527782 17:41242783-41242805 CTGGGTACATAACAAAATGAAGG + Intronic
1149015048 17:51899292-51899314 TTTGTTAAACAACAAAATCAAGG - Intronic
1149961347 17:61112988-61113010 CTGGATACATAACGAAATGAAGG + Intronic
1150884886 17:69073502-69073524 CTGGGTACATAACAAAATTAAGG + Intergenic
1151063887 17:71128827-71128849 TTGGAGACACCACAAAATCTTGG - Intergenic
1203168317 17_GL000205v2_random:120510-120532 TTGGGTAAACAACAAAATTGAGG + Intergenic
1153102854 18:1494236-1494258 TTGGATAAACAATGAAATTAAGG - Intergenic
1153278226 18:3390058-3390080 TAGTATACACAACCAAAACAAGG - Intergenic
1153384331 18:4475388-4475410 CTGGATACATAACGAAATGAAGG - Intergenic
1153402623 18:4697550-4697572 CTGGGTACATAACAAAATGAAGG + Intergenic
1153430139 18:5006895-5006917 CTGGGTACATAACAAAATGAAGG + Intergenic
1153542103 18:6166579-6166601 CTGGGTACATAACAAAATGAAGG + Intronic
1153727259 18:7969208-7969230 CTGGGTACATAACAAAATGAAGG + Intronic
1154097730 18:11433625-11433647 TTGGATAAACAATGAAATGAAGG + Intergenic
1154100424 18:11467772-11467794 TAGGAAAGACAACAAAAACAAGG - Intergenic
1154320411 18:13346319-13346341 CTGGGTACATAACAAAATGAAGG - Intronic
1154364323 18:13692648-13692670 CTGGATACATAACCAAATGAAGG + Intronic
1155120251 18:22811866-22811888 CTGGGTACATAACAAAATGAAGG - Intronic
1155476624 18:26241825-26241847 CTGGATACATAACGAAATGAAGG - Intronic
1155579092 18:27282312-27282334 CTGGGTACATAACAAAATGAAGG + Intergenic
1155598224 18:27512776-27512798 CTGGGTACATAACAAAATGAAGG + Intergenic
1155617678 18:27740967-27740989 CTGGATACATAACGAAATGAAGG - Intergenic
1155795011 18:30025090-30025112 CTGGGTACACAACGAAATGAAGG - Intergenic
1156002246 18:32398065-32398087 CTGGGTACATAACAAAATGAAGG + Intronic
1156044213 18:32859896-32859918 CTGGGTACATAACAAAATGAAGG - Intergenic
1156143037 18:34139919-34139941 CTGGGTACATAACAAAATGAAGG - Intronic
1156158737 18:34333869-34333891 CTGGGTACATAACAAAATGAAGG + Intergenic
1156176732 18:34555616-34555638 CTGGATACATAACGAAATGAAGG - Intronic
1156217851 18:35019070-35019092 TTGGGTAAACAATAAAATTAAGG - Intronic
1156292798 18:35763147-35763169 CTGGGTACATAACAAAATGAAGG + Intergenic
1156426312 18:37017198-37017220 TTGGGTAAATGACAAAATCAAGG - Intronic
1156433298 18:37099315-37099337 CTGGGTACACAACAAAATGAAGG - Intronic
1156725033 18:40117300-40117322 CTGGGTACATAACAAAATGAAGG - Intergenic
1156843322 18:41634507-41634529 CTGGATACATAACGAAATGAAGG + Intergenic
1156855626 18:41777780-41777802 CTGGGTACATAACAAAATGAAGG + Intergenic
1157074004 18:44444903-44444925 CTGGGTACATAACAAAATGAAGG + Intergenic
1157631811 18:49105648-49105670 CTGGATACATAACGAAATGAAGG - Intronic
1157983942 18:52416113-52416135 TTGAGTACATAACAAAATGAAGG - Intronic
1158074658 18:53514202-53514224 TTGGGTACATAACGAAATGAAGG + Intronic
1159170517 18:64760418-64760440 TTGGATAAACAATGAAATCAAGG + Intergenic
1159349524 18:67253708-67253730 CTGGGTACATAACAAAATGAAGG - Intergenic
1159573777 18:70150548-70150570 TTAGATACTCAGCTAAATCAAGG - Intronic
1159807053 18:72969770-72969792 CTGGGTACATAACAAAATGAAGG - Intergenic
1159832991 18:73300859-73300881 TTAAAGACACAACAAAATAATGG + Intergenic
1159979102 18:74754589-74754611 CTGGGTACATAACAAAATGAAGG - Intronic
1160016782 18:75149066-75149088 TTGGGTAAACAATAAAATCAAGG - Intergenic
1164018884 19:21279426-21279448 TTGAATCAACAACAAAATTAAGG - Intronic
1164165932 19:22674813-22674835 CTGGGTACATAACAAAATGAAGG + Intergenic
1164367200 19:27598513-27598535 CTGGCTACAAAACAAAATGAAGG + Intergenic
1164420811 19:28090528-28090550 CTGGGTACATAACAAAATGAAGG + Intergenic
1164486607 19:28661619-28661641 TTGGGTAAACAACAAACTTATGG + Intergenic
1165262113 19:34628022-34628044 CTGGGTACATAACAAAATGAAGG + Intronic
1165270552 19:34703622-34703644 CTGGGTACATAACAAAATAAAGG - Intergenic
1165673512 19:37700595-37700617 ATGGGTACACATCATAATCATGG + Intronic
1165980909 19:39722594-39722616 CTGGGTACATAACAAAATGAAGG + Intergenic
1166156454 19:40915569-40915591 CTGGGTACATAACAAAATGAAGG + Intergenic
1166240546 19:41489260-41489282 CTGGGTACATAACAAAATGAAGG + Intergenic
1166489370 19:43245295-43245317 CTGGGTACATAACAAAATGAAGG - Intronic
1168308453 19:55449415-55449437 GTGGACACACAACACAAACATGG + Intergenic
1202653616 1_KI270707v1_random:28582-28604 CTGGGTACATAACAAAATGAAGG + Intergenic
1202670595 1_KI270709v1_random:46675-46697 CTGGGTACATAACAAAATGAAGG + Intergenic
925133220 2:1509126-1509148 CTGGATACATAACAAAATGAAGG - Intronic
925173015 2:1762816-1762838 CTGGGTACATAACAAAATGAAGG + Intergenic
925855855 2:8128695-8128717 CTGGATACATAACGAAATGAAGG + Intergenic
925963531 2:9041217-9041239 CTGGATACATAACGAAATGAAGG + Intergenic
926507624 2:13736504-13736526 CTGGGTACATAACAAAATGAAGG - Intergenic
926568511 2:14504695-14504717 CTGGGTACATAACAAAATGAAGG - Intergenic
926595585 2:14786562-14786584 CTGGGTACATAACAAAATGAAGG - Intergenic
926659033 2:15442403-15442425 CTGGGTACATAACAAAATGAAGG + Intronic
926929231 2:18020333-18020355 TTGGGTAAAGAACAAAATTAAGG - Intronic
927400580 2:22705974-22705996 CTGGGTACATAACAAAATGAAGG + Intergenic
927426499 2:22986924-22986946 CTGGATACATAACGAAATGAAGG + Intergenic
927564358 2:24098034-24098056 CTGGATACATAACGAAATGAAGG + Intronic
928380822 2:30816573-30816595 CTGGGTACATAACAAAATGAAGG + Intronic
928629178 2:33172905-33172927 CTGGGTACATAACAAAATGAAGG + Intronic
928795618 2:35015333-35015355 CTGGGTACATAACAAAATGAAGG + Intergenic
928802346 2:35110093-35110115 CTGGGTACATAACAAAATGAAGG - Intergenic
928811832 2:35236651-35236673 CTGGGTACATAACAAAATGAAGG + Intergenic
928900508 2:36313075-36313097 CTGGGTACATAACAAAATGAAGG - Intergenic
929016094 2:37496930-37496952 TTGGGTAAACAGCAAAATTAAGG - Intergenic
929258105 2:39835869-39835891 TTGGGTAAACAATAAAATTAAGG - Intergenic
929765895 2:44843842-44843864 TTGGAAAGACCACAGAATCAGGG - Intergenic
929796438 2:45062797-45062819 CTGGATACATAACGAAATGAAGG - Intergenic
929798444 2:45078513-45078535 CTGGATACATAACGAAATGAAGG + Intergenic
930210464 2:48631897-48631919 TTGGGTAAACAACAAAGTTAAGG - Intronic
930220624 2:48742593-48742615 CTGGGTACATAACAAAATGAAGG + Intronic
930433857 2:51315948-51315970 CTGGGTACATAACAAAATGAAGG - Intergenic
930885374 2:56320039-56320061 CTGGGTACATAACAAAATGAAGG + Intronic
930954190 2:57184792-57184814 TTGCGTAAACAACAAAATTAAGG + Intergenic
930986032 2:57589173-57589195 TTGGGTACATAACGAAATGAAGG + Intergenic
930987845 2:57611585-57611607 TTGGGTACATAACGAAATGAAGG + Intergenic
931031000 2:58174539-58174561 CTGGGTACATAACAAAATGAAGG + Intronic
931144032 2:59496962-59496984 TTGGGTAAACAATAAAATTAAGG - Intergenic
931477897 2:62608119-62608141 CTGGATACATAACGAAATGAAGG + Intergenic
931481784 2:62648958-62648980 CTGGATACATAACGAAATGAAGG - Intergenic
931543676 2:63356675-63356697 TTGGATAAACAATGAAATTAAGG + Intronic
931864414 2:66393885-66393907 CTGGGTACATAACAAAATGAAGG + Intergenic
931889779 2:66659039-66659061 TTGGATACATAATGAAATTAAGG - Intergenic
932019327 2:68066643-68066665 CTGGGTACATAACAAAATGAAGG + Intronic
932470923 2:71956146-71956168 TTGAATAGACAACAAAATTAGGG + Intergenic
932473375 2:71980185-71980207 TTGGATTAACAATGAAATCAAGG + Intergenic
932992942 2:76810781-76810803 TTGGCTAAACAATAAAAGCATGG + Intronic
933130499 2:78666974-78666996 TTGGGTAAATAACAAAATTAAGG + Intergenic
933568478 2:83979282-83979304 CTGGGTACATAACAAAATGAAGG + Intergenic
933590550 2:84227638-84227660 CTGGATACATAACGAAATGAAGG + Intergenic
933638860 2:84738086-84738108 TTGGGTAAACAATGAAATCAAGG - Intronic
934250830 2:90353584-90353606 CTGGGTACATAACAAAATGAAGG - Intergenic
934258735 2:91449826-91449848 CTGGGTACATAACAAAATGAAGG + Intergenic
934802223 2:97175865-97175887 CTGGGTACATAACAAAATGAAGG - Intronic
934806179 2:97228877-97228899 CTGGGTACATAACAAAATGAAGG - Intronic
934912041 2:98267440-98267462 CTGGGTACATAACAAAATGAAGG + Intronic
935003423 2:99044931-99044953 CTGGGTACATAACAAAATGAAGG + Intronic
935339250 2:102045275-102045297 TTATATAAAAAACAAAATCACGG - Intergenic
935450501 2:103203437-103203459 CTGGGTACATAACAAAATGAAGG + Intergenic
935500073 2:103828456-103828478 TTGGGTAAACAATAAAATTAAGG - Intergenic
936003667 2:108861934-108861956 TTGGGTAAACAACAAAATTAAGG - Intronic
936173125 2:110193908-110193930 CTGGATACATAACGAAATGAAGG + Intronic
936553734 2:113474729-113474751 CTGGGTACATAACAAAATGAAGG - Intronic
936727107 2:115332665-115332687 CTGGGTACATAACAAAATGAAGG - Intronic
936782598 2:116052182-116052204 CTGGGTACATAACAAAATGAAGG - Intergenic
936801977 2:116280955-116280977 TTGGGTAAGCAACAAAATGAAGG + Intergenic
936806168 2:116335011-116335033 CTGGGTAAACAACAAAATGAAGG - Intergenic
936823785 2:116555681-116555703 CTGGCTACATAACAAAATGAAGG + Intergenic
936929165 2:117769253-117769275 CTGGATACATAACGAAATGAAGG - Intergenic
937063490 2:118998589-118998611 CTGGGTACATAACAAAATGAAGG - Intergenic
937489355 2:122349529-122349551 CTGGATACATAACGAAATGAAGG - Intergenic
937553064 2:123118838-123118860 TTGAGTAAACAACAAAATTAGGG + Intergenic
937633157 2:124125814-124125836 CTGGGTACATAACAAAATGAAGG + Intronic
937634725 2:124142540-124142562 CTGGATACATAACGAAATGAAGG + Intronic
937659148 2:124410630-124410652 CTGGATACATAACGAAATGAAGG + Intronic
937676429 2:124596379-124596401 CTGGATACATAACGAAATGAAGG - Intronic
937754476 2:125519122-125519144 TTGGGTAAAAAACAAAATTAAGG + Intergenic
937803126 2:126103852-126103874 CTGGGTACACAACGAAATGAAGG + Intergenic
938167234 2:129041383-129041405 CTGGGTACATAACAAAATGAAGG - Intergenic
938167877 2:129047939-129047961 CTGGGTACATAACAAAATGAAGG - Intergenic
938217716 2:129534697-129534719 CTGGGTACATAACAAAATGAAGG + Intergenic
938445703 2:131376177-131376199 CTGGGTACATAACAAAATGAAGG + Intergenic
938704751 2:133913246-133913268 CTGGCTACATAACAAAATGAAGG + Intergenic
938864670 2:135405721-135405743 CTGGGTACATAACAAAATGAAGG + Intronic
938871679 2:135483852-135483874 CTGGGTACATAACAAAATGAAGG - Intronic
939058847 2:137396404-137396426 CTGGATACATAACGAAATGAAGG - Intronic
939211460 2:139180532-139180554 TTAGATAAACAACAATACCATGG - Intergenic
939555148 2:143664318-143664340 CTGGATACATAACGAAATGAAGG + Intronic
939594499 2:144107007-144107029 CTGGGTACATAACAAAATGAAGG + Intronic
939668724 2:144982535-144982557 TTGGTTAGAAAACAAAAGCAAGG - Intergenic
939744215 2:145949421-145949443 CTGGGTACATAACAAAATGAAGG - Intergenic
939975056 2:148707749-148707771 CTGGGTACATAACAAAATGAAGG + Intronic
940055018 2:149504484-149504506 CTGGGTACATAACAAAATGAAGG - Intergenic
940080313 2:149793853-149793875 CTGGGTACATAACAAAATGAAGG - Intergenic
940085434 2:149853208-149853230 CTGGGTACATAACAAAATGAAGG + Intergenic
940404036 2:153280602-153280624 TTGGGTGAACAACAAAATTAAGG - Intergenic
940523501 2:154782033-154782055 TTGTATACACCTCAATATCACGG - Intronic
940703044 2:157070494-157070516 CTGGATAAATAACAAAATGAAGG + Intergenic
940819057 2:158331247-158331269 CTGGGTACATAACAAAATGAAGG - Intronic
940819229 2:158333261-158333283 CTGGGTAAATAACAAAATCAAGG - Intronic
940996090 2:160151346-160151368 CTGGGTACATAACAAAATGAAGG + Intronic
941121096 2:161531202-161531224 TAGGACACAAATCAAAATCAGGG + Intronic
941323583 2:164085464-164085486 TTGTAAACACTACAAAATCTAGG + Intergenic
941458142 2:165734907-165734929 CTGGGTACATAACAAAATGAAGG - Intergenic
941559780 2:167030454-167030476 CTGGGTACATAACAAAATTAAGG - Intronic
941587318 2:167377078-167377100 TTGGGTAAACAACAAAATCAAGG - Intergenic
941602597 2:167561205-167561227 TTGGGTACATAACAAAATGAAGG + Intergenic
941858863 2:170257488-170257510 TTGGGTAAATAACAAAATTAAGG + Intronic
942399976 2:175591793-175591815 CTGGGTACATAACAAAATGAAGG - Intergenic
942416276 2:175762362-175762384 CTGGATACATAACGAAATGAAGG + Intergenic
942677181 2:178439716-178439738 TTGGAAAAAAACCAAAATCATGG - Intronic
942753818 2:179317385-179317407 CTGGGTACATAACAAAATGAAGG + Intergenic
942788134 2:179725357-179725379 TTGTATAGTCAACAAAAACAAGG + Intronic
942836216 2:180301648-180301670 CTGGGTACATAACAAAATGAAGG - Intergenic
943031364 2:182689429-182689451 CTGGGTACATAACAAAATGAAGG + Intergenic
943036190 2:182748896-182748918 CTGGGTACATAACAAAATGAAGG - Intronic
943205941 2:184895728-184895750 TTGAAAACAAAAGAAAATCAAGG - Intronic
943274021 2:185844972-185844994 CTGGATACATAACGAAATGAAGG - Intergenic
943275980 2:185867362-185867384 CTGGATACATAACGAAATGAAGG + Intergenic
943310231 2:186315671-186315693 CTGGATACATAACAAAATGAAGG + Intergenic
943410068 2:187535485-187535507 CTGGGTAAATAACAAAATCAAGG + Intronic
943775834 2:191764613-191764635 CTGGGTACATAACAAAATGAAGG + Intergenic
943942068 2:194011111-194011133 CTGGGTACATAACAAAATGAAGG - Intergenic
944018258 2:195070763-195070785 CTGGATACATAACAAAATGAAGG - Intergenic
944030700 2:195231201-195231223 CTGGGTACATAACAAAATGAAGG + Intergenic
944266431 2:197731715-197731737 CTGGGTACATAACAAAATGAAGG + Intronic
944307970 2:198199130-198199152 CTGGGTACATAACAAAATGAAGG + Intronic
944339821 2:198583001-198583023 CTGGATACATAACGAAATGAAGG + Intergenic
944378253 2:199074497-199074519 TTGGGTAAATAACAAAATGAAGG + Intergenic
944486818 2:200215545-200215567 ATGCACACACAAAAAAATCAAGG - Intergenic
944600971 2:201302831-201302853 CTGGGTACATAACAAAATGAAGG + Intronic
944628070 2:201593222-201593244 CTGGGTACATAACAAAATGAAGG - Intronic
945347548 2:208736502-208736524 TTGGATAAACAACAAAATTAAGG - Intronic
945349724 2:208763022-208763044 CTGGGTACACAACGAAATGAAGG + Intronic
945351630 2:208787165-208787187 CTGGATACATAACGAAATGAAGG + Intronic
945353871 2:208814382-208814404 CTGGATACATAACGAAATGAAGG + Intronic
945667430 2:212759524-212759546 CTGGGTACACAACGAAATGAAGG + Intergenic
945873794 2:215255857-215255879 CTGGGTACATAACAAAATGAAGG + Intergenic
946659821 2:221987328-221987350 CTGGATACATAACGAAATGAAGG + Intergenic
947225567 2:227836916-227836938 CTGGATAAATAACAAAATTAAGG - Intergenic
947241970 2:228004797-228004819 CTGGGTACATAACAAAATGAAGG - Intronic
947244706 2:228033780-228033802 CTGGATACATAACGAAATGAAGG + Intronic
947327586 2:228994575-228994597 TTGGCTAGAAAACAAAATAATGG - Intronic
947465338 2:230339736-230339758 CTGGGTACATAACAAAATGAAGG - Intronic
948239844 2:236421066-236421088 CTGGGTACATAACAAAATGAAGG - Intronic
948498822 2:238375370-238375392 CTGGGTACATAACAAAATGAAGG - Intronic
1168740319 20:184310-184332 TTGGATAAACAACAAAATGAAGG + Intergenic
1168882529 20:1219628-1219650 CTGGGTACATAACAAAATGAAGG + Intergenic
1170070654 20:12362807-12362829 CTGGGTACATAACAAAATGAAGG - Intergenic
1170385537 20:15812143-15812165 TTGTAAACTGAACAAAATCAGGG + Intronic
1171076515 20:22132074-22132096 CTGGGTACATAACAAAATGAAGG + Intergenic
1171281184 20:23900092-23900114 CTGGGTACACAACGAAATGAAGG - Intergenic
1171362266 20:24596196-24596218 TTGGGTAAACAATAAAATTAGGG - Intronic
1171404790 20:24903358-24903380 CTGGATACATAACGAAATGAAGG + Intergenic
1171407860 20:24924611-24924633 CTGGGTACATAACAAAATGAAGG + Intergenic
1171466593 20:25332707-25332729 CTGGGTACATAACAAAATGAAGG + Intronic
1171514342 20:25716895-25716917 CTGGGTACATAACAAAATGAAGG - Intergenic
1173086011 20:39918842-39918864 CTGGGTACATAACAAAATGAAGG - Intergenic
1173294527 20:41744748-41744770 TTGGGTAAACAACAAAATTAAGG - Intergenic
1173347765 20:42216497-42216519 TGGGATACAAAACAGAAGCAAGG - Intronic
1173389330 20:42618180-42618202 TTGGGTACATAACGAAATGAAGG - Intronic
1173770704 20:45654332-45654354 CTGGGTACATAACAAAATGAAGG + Intronic
1174234101 20:49073784-49073806 TTTGATATAAAACAAAATCTTGG - Intronic
1174794036 20:53506614-53506636 CTGGATACATAACGAAATGAAGG + Intergenic
1174937351 20:54885398-54885420 TTGGGTACATAACGAAATGAAGG - Intergenic
1174966628 20:55223561-55223583 CTGGGTACATAACAAAATGAAGG - Intergenic
1175022739 20:55868223-55868245 TTGGATAAACAAAAAAATTAAGG + Intergenic
1175025990 20:55903467-55903489 CTGGGTACATAACAAAATGAAGG - Intergenic
1175660356 20:60807428-60807450 TTGGATACACAAATAAATGGGGG - Intergenic
1175735093 20:61380035-61380057 TTGAATATTCAACAAAAGCAAGG + Intronic
1176319426 21:5295630-5295652 CTGGATACATAACAAAATGAAGG - Intergenic
1176322928 21:5351510-5351532 CTGGGTACATAACAAAATGAAGG + Intergenic
1176325688 21:5447837-5447859 TTGGGTAAACAACAAAATTGAGG + Intergenic
1176333243 21:5570167-5570189 TTGGATAAACAAAAAAATTAAGG - Intergenic
1176394514 21:6250785-6250807 TTGGATAAACAAAAAAATTAAGG + Intergenic
1176403440 21:6338625-6338647 TTGGGTAAACAACAAAATTGAGG - Intergenic
1176433717 21:6650479-6650501 TTGGGTAAACAACAAAATTGAGG + Intergenic
1176442643 21:6738319-6738341 TTGGATAAACAAAAAAATTAAGG - Intergenic
1176466905 21:7065389-7065411 TTGGATAAACAAAAAAATTAAGG - Intronic
1176480581 21:7283130-7283152 CTGGGTACATAACAAAATGAAGG + Intergenic
1176490466 21:7447167-7447189 TTGGATAAACAAAAAAATTAAGG - Intergenic
1176510176 21:7691216-7691238 TTGGATAAACAAAAAAATTAAGG + Intergenic
1176587944 21:8608032-8608054 CTGGGTACATAACAAAATGAAGG + Intergenic
1176687899 21:9869332-9869354 TTGCTTAAAAAACAAAATCAAGG - Intergenic
1176688575 21:9877382-9877404 TTGTGTAAACAATAAAATCAAGG - Intergenic
1176915819 21:14624027-14624049 CTGGGTACACAACGAAATGAAGG + Intronic
1176930397 21:14802984-14803006 CTGGGTACATAACAAAATGAAGG + Intergenic
1176978100 21:15347261-15347283 TTAGGTAAACAACAAAATTAAGG + Intergenic
1177094549 21:16816611-16816633 ATAGATACACAACAAAAAGACGG - Intergenic
1177120908 21:17135768-17135790 TTGGATAAACAACAAATTTAAGG + Intergenic
1177132419 21:17274305-17274327 CTGGGTACACAACGAAATGAAGG + Intergenic
1177253976 21:18635210-18635232 TTGGGTAAACAATGAAATCAAGG + Intergenic
1177294539 21:19157885-19157907 CTGGGTAAATAACAAAATCAGGG - Intergenic
1177393412 21:20504542-20504564 TTGAGTAAACAACAAAATTATGG - Intergenic
1177566805 21:22833485-22833507 TTGGGTAAACAACAAAGTCAAGG + Intergenic
1177764040 21:25436374-25436396 CTGGGTACATAACAAAATTAAGG + Intergenic
1177943108 21:27435178-27435200 CTGGTTACATAACAAAATGAAGG - Intergenic
1178044681 21:28679801-28679823 TTGGGTACATAACGAAATGAAGG + Intergenic
1178593118 21:33928825-33928847 CTGGGTACATAACAAAATGAAGG - Intergenic
1180270776 22:10585031-10585053 CTGGGTACATAACAAAATGAAGG + Intergenic
1180397469 22:12366734-12366756 CTGGATACGTAACAAAATGAAGG - Intergenic
1180399098 22:12391736-12391758 CTGGGTACATAACAAAATGAAGG + Intergenic
1180402251 22:12497401-12497423 CTGGATACATAACAAAATGAAGG + Intergenic
1180507153 22:16023779-16023801 CTGGATACATAACAAAATGAAGG + Intergenic
1180599197 22:17003581-17003603 CTGGGTAAATAACAAAATCAAGG + Intronic
1181555159 22:23665865-23665887 CTGGGTACATAACAAAATGAAGG + Intergenic
1182157282 22:28086414-28086436 CTGGGTACATAACAAAATGAAGG + Intronic
1182177957 22:28312612-28312634 CTGGGTACATAACAAAATGAAGG + Intronic
1182961278 22:34477618-34477640 GTGGATAGATAAGAAAATCAGGG + Intergenic
1182989014 22:34748874-34748896 CTGGGTACATAACAAAATGAAGG - Intergenic
1185157486 22:49202960-49202982 TAGGAAACAAAACAAAATCCAGG - Intergenic
1203236289 22_KI270732v1_random:4618-4640 CTGGGTACATAACAAAATGAAGG + Intergenic
949201958 3:1390311-1390333 CTGGATACATAACGAAATGAAGG + Intronic
949217442 3:1586537-1586559 TTTGTTAAACAACAAAATTAAGG + Intergenic
949352789 3:3142017-3142039 TTGGAAACAAGCCAAAATCATGG - Intronic
949424142 3:3898065-3898087 CTGGGTACATAACAAAATGAAGG + Intronic
949425523 3:3911685-3911707 CTGGGTACATAACAAAATGAAGG + Intronic
949440430 3:4074240-4074262 CTGGATAAATAACAAAATGAAGG + Intronic
949446010 3:4134369-4134391 CTGGGTACATAACAAAATGAAGG + Intronic
949588598 3:5468609-5468631 TTGTTTCCACAACACAATCAAGG + Intergenic
949666378 3:6343705-6343727 CTGGGTACATAACAAAATGAAGG + Intergenic
949717287 3:6948295-6948317 CTGGGTACATAACAAAATGAAGG - Intronic
949766137 3:7528755-7528777 TTGAGTAAACAACAAAATTAGGG - Intronic
949816222 3:8061375-8061397 CTGGGTACATAACAAAATGAAGG - Intergenic
949889059 3:8718838-8718860 CTGGGTACATAACAAAATGAAGG + Intronic
950147303 3:10659998-10660020 CTGGATACATAACGAAATGAAGG + Intronic
950757653 3:15189431-15189453 CTGGGTACATAACAAAATGAAGG + Intergenic
950848675 3:16041096-16041118 TTGGGTAAACAATAAAATTAAGG - Intergenic
950919484 3:16679490-16679512 CTGGGTACATAACAAAATGAAGG + Intergenic
951135514 3:19100569-19100591 CTGGATACATAACGAAATGAAGG - Intergenic
951155878 3:19352634-19352656 CTGGATACATAACGAAATGAAGG + Intronic
951174381 3:19582045-19582067 CTGGGTACATAACAAAATGAAGG + Intergenic
951175427 3:19593502-19593524 CTGGGTACATAACAAAATGAAGG - Intergenic
951237833 3:20255335-20255357 TTGTGTAAACAACAAAATTAAGG - Intergenic
951286350 3:20818642-20818664 CTGGGTACATAACAAAATGAAGG - Intergenic
951324183 3:21282978-21283000 CTGGATAAATAACAAAATTAAGG - Intergenic
951361087 3:21725083-21725105 CTGGATAAATAACAAAATGAGGG + Intronic
951381185 3:21986408-21986430 CTGGGTACATAACAAAATGAAGG - Intronic
951417731 3:22445759-22445781 CTGGGTACATAACAAAATGAAGG - Intergenic
951474453 3:23090549-23090571 CTGGGTACATAACAAAATGAAGG - Intergenic
951516287 3:23563310-23563332 CTGGGTACATAACAAAATGAAGG - Intronic
951570410 3:24056734-24056756 CTGGGTACATAACAAAATGAAGG - Intergenic
951585026 3:24206402-24206424 CTGGGTACATAACAAAATGAAGG + Intronic
951676165 3:25244552-25244574 CTGGGTAAACAACAAAATGAAGG - Intronic
951684751 3:25331426-25331448 CTGGATACATAACAAAACGAAGG + Intronic
951759607 3:26130725-26130747 TTAGTTACACAACAAAATTGAGG + Intergenic
951769727 3:26242303-26242325 CTGGGTACATAACAAAATGAGGG - Intergenic
951830945 3:26926482-26926504 CAGCATACACAACTAAATCAAGG - Intergenic
951860663 3:27248644-27248666 TTGGATACTCTACAAACACATGG - Intronic
952028181 3:29109347-29109369 CTGGGTACATAACAAAATGAAGG - Intergenic
952165717 3:30746409-30746431 TTGGTTTCACATTAAAATCATGG - Intronic
952518870 3:34134203-34134225 TTGAACAAACAACAAAATTAAGG + Intergenic
952546960 3:34430982-34431004 CTGGGTACATAACAAAATGAAGG - Intergenic
952560723 3:34590284-34590306 TTGGGTAAACAACAAAATTAAGG - Intergenic
952587194 3:34907009-34907031 CTGGGTACATAACAAAATGAAGG + Intergenic
952630302 3:35457329-35457351 CTGGGTACATAACAAAATGAAGG + Intergenic
952642229 3:35611317-35611339 CTGGGTACATAACAAAATGAAGG + Intergenic
952700642 3:36323849-36323871 CTGGGTACACAACGAAATGAAGG + Intergenic
952729570 3:36624738-36624760 CTGGGTACACAACGAAATGAAGG - Intergenic
952837451 3:37616205-37616227 CTGGGTACATAACAAAATGAAGG - Intronic
952950322 3:38518820-38518842 TTTTATAGACAAGAAAATCAAGG + Intronic
953105578 3:39875581-39875603 CTGGGTACATAACAAAATGAAGG - Intronic
953106599 3:39887090-39887112 CTGGGTACATAACAAAATGAAGG + Intronic
953112498 3:39956429-39956451 ATGGGTACATAACAAAATGAAGG + Intronic
953145886 3:40274246-40274268 CTGGGTACATAACAAAATGAAGG + Intergenic
953266152 3:41390607-41390629 CTGGGTACATAACAAAATGAAGG - Intronic
953354250 3:42241386-42241408 CTGGGTACATAACAAAATGAAGG + Intergenic
953523162 3:43662307-43662329 TTGGGTACATAACAAAATGAAGG + Intronic
953721690 3:45361622-45361644 TTGGGTAAAGAACAAAATTAAGG - Intergenic
954485505 3:50847211-50847233 TTGGGTAAACAACAAAATTAAGG - Intronic
954491171 3:50906996-50907018 CTGGGTACATAACAAAATGAAGG - Intronic
954492573 3:50920989-50921011 CTGGGTACATAACAAAATAAAGG - Intronic
954524103 3:51254107-51254129 CTGGGTACATAACAAAATGAAGG - Intronic
955440469 3:58949524-58949546 CTGGATACATAACGAAATGAAGG - Intronic
955477879 3:59358033-59358055 CTGGGTACATAACAAAATCAAGG - Intergenic
955681061 3:61502767-61502789 TTGGACAAATAACAAAATTAAGG - Intergenic
955895692 3:63697142-63697164 CTGGGTACATAACAAAATGAAGG + Intergenic
956207135 3:66766897-66766919 CTGGGTACATAACAAAATGAAGG - Intergenic
956215643 3:66845685-66845707 CTGGGTACATAACAAAATGAAGG + Intergenic
956255526 3:67279348-67279370 CTGGGTACATAACAAAATGAAGG - Intergenic
956269046 3:67430351-67430373 CTGGGTACATAACAAAATGAAGG + Intronic
956560782 3:70571822-70571844 GTGGTTACACAACAATATGAAGG - Intergenic
956589220 3:70896048-70896070 CTGGGTACATAACAAAATGAAGG - Intergenic
956866217 3:73371698-73371720 CTGGGTACATAACAAAATGAAGG - Intergenic
957488585 3:80894887-80894909 CTGGATACATAACGAAATGAAGG - Intergenic
957597889 3:82290772-82290794 TTGGTTAAACAATAAAATTAGGG + Intergenic
957603881 3:82373535-82373557 CTGGGTACATAACAAAATGAAGG - Intergenic
957696126 3:83639761-83639783 TTGGGTAAATAACAAAATTAAGG + Intergenic
957780548 3:84813004-84813026 CTGGGTACATAACAAAATGAAGG - Intergenic
957942253 3:87019983-87020005 CTGGGTACATAACAAAATGAAGG + Intergenic
958171181 3:89942325-89942347 CTGGGTACATAACAAAATGAAGG - Intergenic
958176200 3:89998860-89998882 CTGGGTACATAACAAAATGAAGG + Intergenic
958184905 3:90108222-90108244 CTGGGTACATAACAAAATGAAGG - Intergenic
958218403 3:90625077-90625099 CTGGATACATAACAAAATGAAGG + Intergenic
958257181 3:91338653-91338675 TTGGGTAAATAACAAAATTAAGG - Intergenic
958412537 3:93835141-93835163 CTGGGTACACAACGAAATGAAGG + Intergenic
958413707 3:93849986-93850008 CTGGGTAAACAACAAAATGAAGG - Intergenic
958423291 3:93952479-93952501 CTGGGTACATAACAAAATGAAGG + Intronic
958479993 3:94633533-94633555 CTGGGTACATAACAAAATGAAGG + Intergenic
958489025 3:94748232-94748254 CTGGGTACATAACAAAATGAAGG + Intergenic
958508609 3:95015427-95015449 CTGGTTACATAACAAAATGAAGG - Intergenic
958624257 3:96604576-96604598 CTGGGTACATAACAAAATGAAGG - Intergenic
958651269 3:96939843-96939865 CTGGGTACATAACAAAATGAAGG - Intronic
958705084 3:97644189-97644211 CTGGATACATAACGAAATTAAGG + Intronic
958726089 3:97907987-97908009 CTGGGTACATAACAAAATGAAGG - Intronic
958823677 3:99004680-99004702 TTGGGTAAACAACAAAATTAAGG - Intergenic
958828590 3:99061906-99061928 CTGGGTACATAACAAAATGAAGG - Intergenic
958848312 3:99291840-99291862 CTGGGTACATAACAAAATGAAGG - Intergenic
958956996 3:100475616-100475638 CTGGGTACATAACAAAATGAAGG - Intergenic
959043925 3:101450614-101450636 CTGGGTACATAACAAAATGAAGG + Intronic
959052564 3:101538450-101538472 CTGGGTACATAACAAAATGAAGG - Intergenic
959308017 3:104694211-104694233 CTGGGTACATAACAAAATGAAGG - Intergenic
959494914 3:107039065-107039087 TTGGGTAAATAACAAAATTAAGG + Intergenic
959725894 3:109541077-109541099 CTGGGTACATAACAAAATGAAGG + Intergenic
959736734 3:109667639-109667661 CTGGGTACATAACAAAATGAAGG + Intergenic
959778874 3:110204085-110204107 CTGGGTACATAACAAAATGAAGG + Intergenic
959955799 3:112236709-112236731 CTGGGTACATAACAAAATGAAGG - Intronic
959974211 3:112439488-112439510 TTGGGTGAACAACAAAATTAGGG + Intergenic
959994148 3:112662390-112662412 CTGGATACATAACGAAATGAAGG - Intergenic
960000550 3:112727012-112727034 TGGGGTACATAACAAAATGAAGG + Intergenic
960012053 3:112844448-112844470 TTGGGTAGACAATAAAATTAAGG + Intronic
960177575 3:114534891-114534913 CTGGGTAAACAACAAAATTAAGG + Intronic
960238711 3:115315558-115315580 CTGGGTACATAACAAAATGAAGG - Intergenic
960318513 3:116206644-116206666 CTGGATACATAACGAAATGAAGG - Intronic
960342378 3:116489676-116489698 TTGGGTAAACAATAAAATTAAGG + Intronic
960612311 3:119566411-119566433 CTGGGTACATAACAAAATGAAGG - Intergenic
960643762 3:119855160-119855182 CTGGATACATAACAAAATGAAGG - Intronic
960693757 3:120375857-120375879 CTGGATACATAACGAAATGAAGG - Intergenic
960783723 3:121349198-121349220 CTGGGTACATAACAAAATGAAGG - Intronic
960793149 3:121455133-121455155 CTGGGTACATAACAAAATGAAGG + Intronic
961227578 3:125266474-125266496 TTGGATAAACAATGAAATCAAGG + Intronic
961395842 3:126589210-126589232 CTGGGTACATAACAAAATGAAGG - Intronic
961419392 3:126789062-126789084 ATGGATACATAACGAAATGAAGG - Intronic
961421041 3:126803964-126803986 ATGGATACATAACGAAATGAAGG + Intronic
962081067 3:132139631-132139653 TTGGGTACATAACGAAATGAAGG + Intronic
962190850 3:133309600-133309622 CTGGGTACATAACAAAATTAAGG - Intronic
962238144 3:133726898-133726920 CTGGGTACATAACAAAATGAAGG - Intergenic
962458544 3:135587482-135587504 CTGGATACATAACGAAATAAAGG + Intergenic
962484087 3:135824867-135824889 CTGGATACATAACGAAATGAAGG + Intergenic
962553823 3:136525836-136525858 ATGGATACATAACGAAATGAAGG - Intronic
962656881 3:137555652-137555674 TTGGGTAAACAACAACATTAAGG + Intergenic
962699479 3:137982728-137982750 CTGGGTACATAACAAAATGAAGG + Intergenic
962761641 3:138520584-138520606 CTGGGTACATAACAAAATGAAGG + Intronic
962907631 3:139819323-139819345 CTGGGTACATAACAAAATGAAGG + Intergenic
962984752 3:140524847-140524869 TTGGGTGAACAACAAAATTAAGG + Intronic
963109326 3:141673075-141673097 CTGGGTACATAACAAAATGAAGG + Intergenic
963332616 3:143932079-143932101 CTGGGTACATAACAAAATGAAGG + Intergenic
963340264 3:144024224-144024246 CTGGGTACATAACAAAATGAAGG + Intronic
963581095 3:147127436-147127458 CTGGATACATAACGAAATGAAGG - Intergenic
963957611 3:151272634-151272656 TTGAGTACACAACCAAATCCTGG + Intronic
964057719 3:152481926-152481948 TTGGGTAAACAATAAAATCAAGG - Intergenic
964061870 3:152535084-152535106 TTAGATAAATAACAAAATTAAGG - Intergenic
964149703 3:153509169-153509191 CTGGATACATAACGAAATGAAGG + Intergenic
964150665 3:153520159-153520181 CTGGATACATAACGAAATGAAGG - Intergenic
964259828 3:154823217-154823239 CTGGGTACATAACAAAATGAAGG - Intergenic
964318787 3:155471828-155471850 CTGGATACATAACGAAATGAAGG + Intronic
964390984 3:156198028-156198050 CTGGGTAAATAACAAAATCAAGG - Intronic
964500479 3:157342928-157342950 CTGGGTACACAACGAAATGAAGG + Intronic
964536484 3:157727461-157727483 CTGGGTACATAACAAAATGAAGG + Intergenic
964652131 3:159023848-159023870 TTGGGTAAACAACAAAACTAAGG - Intronic
964696012 3:159508708-159508730 CTGGGTACATAACAAAATGAAGG - Intronic
964715513 3:159717132-159717154 CTGGGTACATAACAAAATGAAGG + Intronic
964842085 3:161005148-161005170 CTGGGTACATAACAAAATGAAGG - Intronic
964919408 3:161877827-161877849 TTGGGTAAACAACAAAATTATGG + Intergenic
964941967 3:162169388-162169410 TTGCATACACAACAAAGAGATGG - Intergenic
964995281 3:162870720-162870742 CTGGATAAATAACAAAATGAAGG + Intergenic
965131398 3:164705373-164705395 CTGGGTACATAACAAAATGAAGG + Intergenic
965177901 3:165359750-165359772 TTGGATATACAACTAAATTCTGG - Intergenic
965224328 3:165968881-165968903 TTAGAGACAAAACAAAATGAGGG + Intergenic
965623635 3:170665610-170665632 CTGGGTACATAACAAAATGAAGG - Intronic
965649724 3:170920924-170920946 TTGGATAAATAACAAAATTAAGG + Intergenic
965686807 3:171312533-171312555 TTGGATACCCACCAAGAACAAGG - Intronic
966147684 3:176829804-176829826 CTGGATACATAACAAAATGAAGG + Intergenic
966269990 3:178093178-178093200 TTGGGTAAATAACAAAATTAAGG + Intergenic
967159214 3:186720375-186720397 TTGTATAGACAGAAAAATCATGG + Intronic
967736916 3:192962868-192962890 CTGGGTACACAACGAAATGAAGG - Intergenic
968296295 3:197578868-197578890 TTGAATACAAAACAAATGCAGGG + Intergenic
969005522 4:4016717-4016739 CTGGGTACATAACAAAATGAAGG - Intergenic
969126931 4:4957131-4957153 CTGGGTACATAACAAAATGAGGG - Intergenic
969187082 4:5483828-5483850 CTGGGTACACAACGAAATGAAGG - Intronic
969191167 4:5521032-5521054 CTGGGTACATAACAAAATGAAGG + Intergenic
969200092 4:5596470-5596492 CTGGGTACATAACAAAATGAAGG + Intronic
969221821 4:5765143-5765165 CTGGATACATAACAAAATGAAGG - Intronic
969807464 4:9620808-9620830 CTGGGTACATAACAAAATGAAGG + Intergenic
969870497 4:10101560-10101582 TTGGCTCCTCTACAAAATCAGGG + Intronic
969952352 4:10851369-10851391 TTGGATAAATAACAAAATTAAGG - Intergenic
969982397 4:11171420-11171442 CTGGATACATAACGAAATGAAGG - Intergenic
970020321 4:11560338-11560360 CTGGGTACATAACAAAATGAAGG + Intergenic
970022047 4:11580619-11580641 CTGGGTACATAACAAAATGAAGG - Intergenic
970085687 4:12343790-12343812 CTGGATACATAACGAAATGAAGG + Intergenic
970096072 4:12464192-12464214 CTGGGTACATAACAAAATGAAGG + Intergenic
970184472 4:13435128-13435150 TTGGGTAAAAAACAAAATTAAGG + Intronic
970489740 4:16559967-16559989 CTGGGTACATAACAAAATGAAGG + Intronic
970666226 4:18340488-18340510 TTGGGTAAATAACAAAATTAAGG - Intergenic
970985248 4:22149191-22149213 CTGGGTACATAACAAAATGAAGG + Intergenic
970999620 4:22307362-22307384 CTGGGTACATAACAAAATGAAGG + Intergenic
971096179 4:23406645-23406667 TTGGGTGAACAACAAAATTAAGG - Intergenic
971114112 4:23623300-23623322 TTGGGTAAACAACAAAATTAAGG + Intergenic
971138033 4:23891163-23891185 TTGAATACATAACAAACTCAAGG + Intronic
971476060 4:27073478-27073500 CTGGATACATAACGAAATGAAGG - Intergenic
971492811 4:27232112-27232134 CTGGGTACATAACAAAATGAAGG - Intergenic
971586425 4:28410173-28410195 CTGGGTACACAACAAAATGAAGG + Intergenic
971621056 4:28854740-28854762 CTGGGTACATAACAAAATGAAGG - Intergenic
971714233 4:30154551-30154573 TTGGGTAAACAACAAACTTAAGG + Intergenic
971726817 4:30325165-30325187 TTTGATAAATAACAAAATTAGGG - Intergenic
971880401 4:32363793-32363815 CTGGATACATAACGAAATGAAGG - Intergenic
972093848 4:35323388-35323410 CTGGATACATAACGAAATGAAGG + Intergenic
972097506 4:35366421-35366443 TTGTATACTGAACAATATCAAGG + Intergenic
972130894 4:35832104-35832126 CTGGGTACATAACAAAATGAAGG + Intergenic
972178515 4:36437318-36437340 CTGGATAGACAACAAAATGAAGG - Intergenic
972198999 4:36690432-36690454 TTGATTAAACAACAAAATAAAGG - Intergenic
972212624 4:36857131-36857153 CTGGGTACATAACAAAATGAAGG + Intergenic
972215082 4:36888793-36888815 TTGGGTAAACAATGAAATCAAGG - Intergenic
972221021 4:36954606-36954628 TTGGGTAAATAACAAAATTAAGG - Intergenic
972368887 4:38402385-38402407 CTGGGTAAACAACAAAATTAAGG - Intergenic
972376796 4:38479354-38479376 CTGGGTACACAACGAAATGAAGG + Intergenic
972824357 4:42739376-42739398 TTGGGTAAACAATAAAATTAAGG + Intergenic
972917099 4:43894737-43894759 TTGGGTACATAACGAAATGAAGG - Intergenic
973006827 4:45018396-45018418 TTGGGTAAACAACAAAATTAAGG - Intergenic
973311457 4:48714022-48714044 CTGGGTACATAACAAAATGAAGG + Intronic
973568805 4:52216386-52216408 CTGGGTACATAACAAAATGAAGG - Intergenic
973648422 4:52972918-52972940 CTGGGTACATAACAAAATGAAGG + Intronic
973682163 4:53331497-53331519 CTGGATACATAACGAAATGAAGG + Intronic
973787306 4:54344358-54344380 TTGGGTCGAAAACAAAATCAAGG + Intergenic
973859206 4:55044172-55044194 CTGGGTACATAACAAAATGAAGG + Intergenic
974133425 4:57785453-57785475 GTGGAAACACAAGAAACTCATGG - Intergenic
974152559 4:58028077-58028099 TTGGGTACATAACGAAATGAAGG + Intergenic
974161102 4:58140872-58140894 ATAGATACACAACAATAACATGG + Intergenic
974216194 4:58850708-58850730 CTGGGTACATAACAAAATGAAGG - Intergenic
974253720 4:59422538-59422560 CTGGGTACATAACAAAATGAAGG + Intergenic
974410545 4:61536120-61536142 TTGGATAAACAACAACATTAAGG - Intronic
974536487 4:63182085-63182107 CTGGGTACATAACAAAATGAAGG - Intergenic
974547938 4:63336469-63336491 CTGGATACATAACAAAATGAGGG + Intergenic
974567167 4:63592503-63592525 TTGGGTAAATAACAAAATGAAGG + Intergenic
974591258 4:63951317-63951339 CTGGGTACATAACAAAATGAAGG - Intergenic
974612841 4:64239019-64239041 CTGGGTACATAACAAAATGAAGG - Intergenic
974619415 4:64336748-64336770 CTGGGTACATAACAAAATGAAGG - Intronic
974643579 4:64665483-64665505 CTGGGTACATAACAAAATGAAGG + Intergenic
974748934 4:66111834-66111856 CTGGGTACATAACAAAATGAAGG + Intergenic
974774343 4:66460565-66460587 CTGGGTACATAACAAAATGAAGG - Intergenic
974908532 4:68086276-68086298 TTGGGTAAACAACAAATTTAAGG + Intronic
974917566 4:68196948-68196970 CTGGATACATAACGAAATGAAGG + Intergenic
974944720 4:68513049-68513071 CTGGGTACATAACAAAATGAAGG - Intergenic
975034836 4:69666772-69666794 CTGGATACATAACGAAATGAAGG + Intergenic
975092548 4:70421147-70421169 CTGGGTACATAACAAAATGAAGG - Intergenic
975157418 4:71087645-71087667 CTGGGTACATAACAAAATGAAGG - Intergenic
975232424 4:71950458-71950480 CTGGGTACATAACAAAATGAAGG + Intergenic
975303892 4:72825108-72825130 CTGGGTACATAACAAAATTAAGG + Intergenic
975352660 4:73363009-73363031 CTGGGTACATAACAAAATGAAGG + Intergenic
975445320 4:74457227-74457249 TTAGATACACAAGAAGTTCATGG + Intergenic
975449557 4:74508232-74508254 CTGGGTAAACAACAAAATGAAGG + Intergenic
975505228 4:75129572-75129594 CTGGATACATAACGAAATGAAGG + Intergenic
975511810 4:75202222-75202244 CTGGGTACATAACAAAATGAAGG - Intergenic
975731416 4:77341300-77341322 CTGGGTACATAACAAAATGAAGG - Intronic
975750385 4:77517047-77517069 CTGGGTACATAACAAAATGAAGG - Intronic
975824416 4:78305102-78305124 CTGGGTACATAACAAAATGAAGG - Intronic
975946083 4:79707315-79707337 CTGGGTACATAACAAAATGAAGG + Intergenic
976079678 4:81341574-81341596 TTGGGTAAATAACAAAATTAAGG - Intergenic
976341914 4:83955423-83955445 CTGGATACATAACGAAATGAAGG - Intergenic
976372147 4:84301544-84301566 CTGGATACATAACGAAATGAAGG + Intergenic
976497892 4:85751657-85751679 TTGTAAACACTACAAAAGCATGG + Intronic
976552326 4:86411141-86411163 CTGGGTAAACAACAAAATTAAGG - Intronic
976563337 4:86526798-86526820 TTGGGTAAACAAAGAAATCAAGG - Intronic
976837520 4:89392095-89392117 CTGGGTACATAACAAAATGAAGG + Intergenic
976924693 4:90482612-90482634 CTGGGTACATAACAAAATGAAGG - Intronic
976925699 4:90492759-90492781 CTGGGTACATAACAAAATGAAGG - Intronic
977004006 4:91542542-91542564 CTGGGTACATAACAAAATGAAGG - Intronic
977023690 4:91789269-91789291 CTGGGTACATAACAAAATGAAGG - Intergenic
977029235 4:91861565-91861587 CTGGGTACATAACAAAATGAAGG - Intergenic
977053988 4:92166021-92166043 TTGAATACACAAGGAAATTAAGG + Intergenic
977084048 4:92571784-92571806 CTGGGTACATAACAAAATGAAGG + Intronic
977108421 4:92919592-92919614 CTGGGTACATAACAAAATGAAGG - Intronic
977164623 4:93679678-93679700 CTGGGTACATAACAAAATGAAGG + Intronic
977333519 4:95666606-95666628 CTGGGTACATAACAAAATGAAGG + Intergenic
977353555 4:95917525-95917547 CTGGGTACATAACAAAATGAAGG + Intergenic
977391198 4:96412438-96412460 CTGGGTACATAACAAAATGAAGG - Intergenic
977511463 4:97967760-97967782 CTGGGTACATAACAAAATGAAGG + Intronic
977581123 4:98726158-98726180 CTGGGTACATAACAAAATGAAGG + Intergenic
977618914 4:99114905-99114927 CTGGGTACATAACAAAATGAAGG - Intergenic
977680721 4:99795877-99795899 CTGGGTACATAACAAAATGAAGG - Intergenic
977696776 4:99974429-99974451 TTGGGTAAATAACAAAATTAAGG + Intergenic
977747023 4:100561162-100561184 TTGGGTCAAGAACAAAATCAAGG + Intronic
977755221 4:100662293-100662315 TTGGAATCACTACAAAATAATGG - Intronic
977822657 4:101492628-101492650 TTGGGTAAATAACAAAATTAAGG - Intronic
977897148 4:102377993-102378015 CTGGGTACATAACAAAATGAAGG - Intronic
977968780 4:103188543-103188565 CTGGGTACATAACAAAATGAAGG + Intronic
977974934 4:103253508-103253530 CTGGGTACATAACAAAATGAAGG - Intergenic
977986455 4:103388279-103388301 CTGGGTACATAACAAAATGAAGG + Intergenic
978024967 4:103862297-103862319 TTGGATACACACCAAGAACTGGG + Intergenic
978030463 4:103935975-103935997 CTGGATAAACATCAAAATTAAGG - Intergenic
978068764 4:104439906-104439928 CTGGGTACATAACAAAATGAAGG + Intergenic
978085986 4:104655632-104655654 TTGGATAGACAATTAAATCAGGG + Intergenic
978096947 4:104789752-104789774 CTGGATACATAAAAAAATGAAGG + Intergenic
978185735 4:105855337-105855359 CTGGGTACATAACAAAATTAAGG - Intronic
978188247 4:105883048-105883070 CTGGGTACATAACAAAATGAAGG + Intronic
978196872 4:105982294-105982316 CTGGGTACATAACAAAATGAAGG - Intronic
978205677 4:106078043-106078065 TTGGGTAAATAACAAAATTAAGG + Intronic
978254083 4:106672768-106672790 CTGGGTACACAACAAAATGAAGG + Intergenic
978257820 4:106713618-106713640 CTGGGTACATAACAAAATGAAGG - Intergenic
978266251 4:106829261-106829283 TTGGATAAAGAAGAAAATTAAGG + Intergenic
978363841 4:107959566-107959588 CTGGGTACATAACAAAATGAAGG + Intergenic
978548320 4:109897543-109897565 CTGGGTACATAACAAAATGAAGG - Intergenic
978757699 4:112321584-112321606 TTGGGTCAACAATAAAATCAAGG - Intronic
978893318 4:113855040-113855062 CTGGGTACATAACAAAATGAAGG + Intergenic
978911876 4:114073279-114073301 TTTGGTAAACAACAAAATTAAGG + Intergenic
979112566 4:116778278-116778300 CTGGGTACATAACAAAATGAAGG - Intergenic
979177578 4:117683390-117683412 CTGGGTACATAACAAAATGAAGG - Intergenic
979205807 4:118036344-118036366 TTATATACACTATAAAATCAGGG + Intronic
979298927 4:119065146-119065168 CTGGGTACATAACAAAATGAAGG - Intergenic
979300052 4:119076528-119076550 CTGGGTACATAACAAAATGAAGG + Intergenic
979417716 4:120463509-120463531 TTGGGTAAATAACAAAATTAAGG + Intergenic
979432741 4:120650880-120650902 CTGGGTACATAACAAAATGAAGG + Intergenic
979445216 4:120804601-120804623 CTGGGTACATAACAAAATGAAGG + Intronic
979449101 4:120848189-120848211 TTGGGAACATAAAAAAATCAAGG + Intronic
979504717 4:121482623-121482645 TTGGGTAAACAACAAAATTAGGG - Intergenic
979581653 4:122367678-122367700 CTGGGTACATAACAAAATGAAGG + Intergenic
979686328 4:123514172-123514194 CTGGGTACATAACAAAATGAAGG + Intergenic
979707007 4:123732456-123732478 TTGGGTAAAAAACAAAATTAAGG - Intergenic
979843489 4:125477242-125477264 TTATACACCCAACAAAATCATGG - Exonic
979886410 4:126032848-126032870 CTGGGTACAGAACAAAATGAAGG + Intergenic
979961227 4:127023330-127023352 CTGGGTACACAACGAAATGAAGG + Intergenic
979964888 4:127065817-127065839 CTGGGTACACAACGAAATGAAGG - Intergenic
980010758 4:127591699-127591721 CTGGGTACATAACAAAATGAAGG + Intergenic
980016202 4:127653462-127653484 CTGGATACATAACGAAATGAAGG - Intronic
980033965 4:127862421-127862443 CTGGGTACAGAACAAAATGAAGG + Intergenic
980139537 4:128898424-128898446 CTGGGTACATAACAAAATGAAGG + Intronic
980196083 4:129590623-129590645 CTGGGTACATAACAAAATGAAGG + Intergenic
980216317 4:129856669-129856691 CTGGATACATAACAAAATGAAGG + Intergenic
980351963 4:131695182-131695204 TTGGGTAAACAATAAAATCAAGG - Intergenic
980413983 4:132460670-132460692 CTGGGTACATAACAAAATGAAGG + Intergenic
980531908 4:134067764-134067786 TTGGACAAACAATAAAATTAAGG - Intergenic
980592141 4:134904047-134904069 CTGGGTACATAACAAAATGAAGG + Intergenic
980632190 4:135450289-135450311 CTGGGTACATAACAAAATGAAGG + Intergenic
980662052 4:135873667-135873689 CTGGGTACATAACAAAATGAAGG - Intergenic
980803817 4:137786546-137786568 CTGGGTACATAACAAAATGAAGG + Intergenic
981068611 4:140511091-140511113 CTGGGTACATAACAAAATGAAGG + Intergenic
981100405 4:140823599-140823621 CTGGATACATAACGAAATGAAGG - Intergenic
981149545 4:141365641-141365663 CTGGGTACATAACAAAATGAAGG - Intergenic
981151169 4:141380662-141380684 CTGGGAACACAACAAAATGAAGG + Intergenic
981199944 4:141968597-141968619 CTGGGTACATAACAAAATGAAGG + Intergenic
981208208 4:142069233-142069255 CTGGGTACATAACAAAATGAAGG + Intronic
981287031 4:143029588-143029610 TTGCATGAACAACAAAATTAAGG + Intergenic
981387717 4:144151149-144151171 CTGGGTACATAACAAAATGAAGG - Intergenic
981456532 4:144959831-144959853 CTGGGTACATAACAAAATGAAGG - Intergenic
981459682 4:144998518-144998540 CTGGGTACATAACAAAATGAAGG + Intronic
981668437 4:147257373-147257395 CTGGGTACATAACAAAATGAAGG + Intergenic
981678668 4:147368733-147368755 ATGCATAAACAACAAAATGATGG - Intergenic
981984457 4:150837035-150837057 CTGGGTACATAACAAAATGAAGG - Intronic
982310592 4:153981320-153981342 CTGGGTACATAACAAAATGAAGG - Intergenic
982327845 4:154147823-154147845 CTGGGTACATAACGAAATCAAGG - Intergenic
982511413 4:156287828-156287850 CTGGATACATAACGAAATGAAGG - Intergenic
982517470 4:156370029-156370051 CTGGATACATAACGAAATGAAGG + Intergenic
982579572 4:157160572-157160594 CTGGATACATAACGAAATGAAGG - Intronic
982638299 4:157924883-157924905 CTGGGTACATAACAAAATGAAGG - Intergenic
982650965 4:158087483-158087505 CTGGGTACATAACAAAATGAAGG - Intergenic
982684033 4:158466439-158466461 CTGGGTACATAACAAAATGAAGG - Intronic
982929409 4:161383620-161383642 TTGAATACACAAGAAAAGAAGGG + Intergenic
983112764 4:163773248-163773270 TTGGATAGACCTCAAAAGCAGGG - Intronic
983137556 4:164103516-164103538 CTGGGTACATAACAAAATGAAGG + Intronic
983172977 4:164556736-164556758 CTGGGTACATAACAAAATGAAGG - Intergenic
983173936 4:164565992-164566014 CTGGGTACATAACAAAATGAAGG + Intergenic
983179718 4:164633342-164633364 CTGGGTACATAACAAAATGAAGG + Intergenic
983244160 4:165268553-165268575 CTGGGTACACAACGAAATGAAGG - Intronic
983292280 4:165821775-165821797 CTGGGTACATAACAAAATGAAGG + Intergenic
983326842 4:166268289-166268311 TTGGGTACATAACGAAATGAAGG + Intergenic
983446642 4:167860657-167860679 CTGGGTACATAACAAAATGAAGG + Intergenic
983690455 4:170463666-170463688 TTGGGTGAACAACAAAATTAAGG - Intergenic
984184983 4:176532891-176532913 TTGGATACAAAACACTATGATGG - Intergenic
984295335 4:177847146-177847168 CTGGATACATAACAAAATGAAGG - Intronic
984370766 4:178861782-178861804 CTGGATACATAACAAAATGAAGG - Intergenic
984549761 4:181146381-181146403 TTTGATTCAAAACAAAATAATGG + Intergenic
984659686 4:182359961-182359983 TTGGGTACATAACGAAATGAAGG - Intronic
985065139 4:186113634-186113656 CTGGATACATAACGAAATGAAGG - Intronic
985204753 4:187523338-187523360 CTGGGTACATAACAAAATTAAGG + Intergenic
986110635 5:4712515-4712537 CTGGGTAAATAACAAAATCAAGG + Intergenic
986490416 5:8283569-8283591 CTGGGTACATAACAAAATGAAGG + Intergenic
986562731 5:9079312-9079334 CTGGATAAATAACAAAATTAAGG + Intronic
986654125 5:9993606-9993628 CTGGGTATACAACAAAATGAAGG + Intergenic
986665004 5:10094219-10094241 CTGGGTACATAACAAAATTAAGG + Intergenic
986874008 5:12083876-12083898 TTGAATACAAAACAAATTCTTGG + Intergenic
986994598 5:13592617-13592639 TTTGATACAGAACAAAAGCAAGG - Intergenic
987157071 5:15099541-15099563 CTGGGTACATAACAAAATGAAGG + Intergenic
987553293 5:19411610-19411632 TTGGGTACACAATCAAATTAAGG - Intergenic
987625105 5:20388789-20388811 CTGGGTACATAACGAAATCAAGG - Intronic
987669945 5:20993526-20993548 TTGGGCAAACAATAAAATCAAGG + Intergenic
987866507 5:23546753-23546775 TTAGATAAACAATAAAATTAAGG - Intergenic
988128744 5:27076200-27076222 TTGGATAAATAATAAAATTAAGG + Intronic
988195553 5:28001097-28001119 TTGGGTAAACAATAAAATTAAGG - Intergenic
988219930 5:28331427-28331449 TTGAGTAAACAACAAAATTAAGG - Intergenic
988284125 5:29189827-29189849 CTGGATACATAACGAAATGAAGG - Intergenic
988287845 5:29244040-29244062 TTGGGTAAACAACAAAATTAAGG + Intergenic
988321731 5:29706474-29706496 TTGAGTACTCACCAAAATCATGG + Intergenic
988671996 5:33391583-33391605 CTGGATAAATAACAAAATGAAGG + Intergenic
989009131 5:36850189-36850211 CTGGATAAATAACAAAATGAAGG + Intergenic
989137804 5:38172741-38172763 CTGGATACATAACGAAATGAAGG - Intergenic
989214998 5:38895000-38895022 TTAGGTAAACAACAAAATGAAGG + Intronic
989234420 5:39129060-39129082 TTGGTTACAACACAAAATCAGGG - Intronic
989528495 5:42480127-42480149 CTGGGTACATAACAAAATGAAGG - Intronic
989545023 5:42662506-42662528 CTGGGTACATAACAAAATGAAGG + Intronic
989607966 5:43263861-43263883 CTGGATACATAACAAAATGAAGG - Intronic
989623251 5:43405397-43405419 CTGGGTACATAACAAAATGAAGG + Intronic
989627260 5:43442086-43442108 CTGGGTACATAACAAAATGAAGG - Intergenic
989660721 5:43794515-43794537 CTGGGTACATAACAAAATGAAGG + Intergenic
989662136 5:43811414-43811436 CTGGGTACATAACAAAATGAAGG - Intergenic
989682303 5:44043818-44043840 CTGGGTACATAACAAAATGAAGG + Intergenic
989683966 5:44063124-44063146 CTGGGTACATAACAAAATGAAGG - Intergenic
989820404 5:45789027-45789049 CTGGGTACATAACAAAATGAAGG + Intergenic
989824370 5:45836082-45836104 CTGGATACATAACGAAATGAAGG - Intergenic
989828158 5:45884471-45884493 CTGGGTACATAACAAAATGAAGG - Intergenic
989949723 5:50282977-50282999 CTGGGTACATAACAAAATGAAGG + Intergenic
989951992 5:50310089-50310111 CTGGGTACATAACAAAATGAAGG + Intergenic
989959162 5:50389881-50389903 CTGGATAAATAACAAAATGAAGG + Intergenic
990071825 5:51791326-51791348 TTGGGTAAACAATAAAATCAAGG + Intergenic
990079224 5:51892122-51892144 TTGCTGACACAACAAATTCAGGG - Intergenic
990110163 5:52313478-52313500 CTGGGTACATAACAAAATAAAGG + Intergenic
990167869 5:53015334-53015356 TTGGGTAAACAACGAAATTAAGG - Intronic
990290190 5:54342077-54342099 TTGGATACACAATCAAATTCTGG + Intergenic
990437336 5:55806565-55806587 CTGGGTACATAACAAAATGAAGG - Intronic
990534703 5:56708846-56708868 TTGGGTAAACAATAAAATTAAGG + Intergenic
990888163 5:60618039-60618061 CTGGGTACATAACAAAATGAAGG + Intronic
991167858 5:63584672-63584694 CTGGGTACATAACAAAATGAAGG + Intergenic
991175256 5:63680210-63680232 TTGGGTACATAACAAAATGAAGG - Intergenic
991421520 5:66447512-66447534 CTGGGTACATAACAAAATGAAGG - Intergenic
991549520 5:67820700-67820722 CTGGGTACATAACAAAATGAAGG + Intergenic
991555684 5:67892363-67892385 CTGGATACATAACGAAATGAAGG + Intergenic
992196829 5:74348341-74348363 CTGGGTACATAACAAAATGAAGG - Intergenic
992220845 5:74571562-74571584 TTGGATAAACAACAAAATTAAGG - Intergenic
992274407 5:75100163-75100185 CTGGGTACATAACAAAATGAAGG - Intronic
992354825 5:75970074-75970096 CTGGGTACATAACAAAATGAAGG + Intergenic
992576739 5:78121094-78121116 CTGGGTACATAACAAAATGAGGG + Intronic
992605827 5:78455424-78455446 CTGGATACATAACGAAATGAAGG - Intronic
992900530 5:81290511-81290533 TTGGGTAAACAAGAAAATTAAGG + Intergenic
993013055 5:82505827-82505849 CTGGATACATAACGAAATGAAGG - Intergenic
993046236 5:82870117-82870139 CTGGGTACATAACAAAATGAAGG - Intergenic
993093946 5:83461044-83461066 CTGGGTACATAACAAAATGAAGG - Intergenic
993341375 5:86729079-86729101 CTGGGTACATAACAAAATGAAGG - Intergenic
993444388 5:87993346-87993368 CTGGGTACATAACAAAATGAAGG + Intergenic
993455588 5:88123129-88123151 CTGGGTACATAACAAAATGAAGG + Intergenic
993528026 5:88990661-88990683 CTGGGTACATAACAAAATGAAGG - Intergenic
993624788 5:90211100-90211122 CTGGGTACATAACAAAATGAAGG + Intergenic
993663338 5:90665854-90665876 CTGGATACATAACGAAATGAAGG - Intronic
993676271 5:90819656-90819678 CTGGATACATAACGAAATGAAGG - Intronic
993789971 5:92196710-92196732 CTGGGTACATAACAAAATGAAGG - Intergenic
993888542 5:93444951-93444973 TTGGGTACATAACAAAATGAAGG + Intergenic
993911833 5:93692953-93692975 TTGGGTAAATAACAAAATTAAGG + Intronic
993917816 5:93763949-93763971 CTGGGTACATAACAAAATGAAGG + Intronic
994031278 5:95146623-95146645 TTGGGTGAACAACAAAATTAAGG - Intronic
994270385 5:97769838-97769860 CTGGGTACATAACAAAATGAAGG - Intergenic
994280827 5:97900394-97900416 CTGGGTACATAACAAAATGAAGG - Intergenic
994559569 5:101350161-101350183 TTGGGTAAACAATAAAATTAAGG + Intergenic
994644100 5:102448111-102448133 TTGGGTAAACAATAAAATTAAGG - Intronic
994948638 5:106428625-106428647 CTGGGTACATAACAAAATGAAGG - Intergenic
994983125 5:106902228-106902250 CTGGGTACATAACAAAATGAAGG - Intergenic
995117083 5:108493318-108493340 CTGGGTACATAACAAAATGAAGG + Intergenic
995171543 5:109119249-109119271 CTGGGTACATAACAAAATGAAGG - Intronic
995178897 5:109211714-109211736 CTGGGTACATAACAAAATGAAGG - Intergenic
995204189 5:109460142-109460164 CTGGGTACATAACAAAATGAAGG + Intergenic
995228791 5:109734611-109734633 CTGGGTACATAACAAAATGAAGG - Intronic
995398413 5:111714434-111714456 CTGGGTAAACAACAAAATTAAGG - Intronic
995578765 5:113572209-113572231 TTGGGTAAATAACAAAATTAAGG - Intronic
995613192 5:113932479-113932501 TTGGGTACATAACGAAATGAAGG - Intergenic
995622094 5:114037812-114037834 TTGGGTAAACAACAAAACTAAGG - Intergenic
995642709 5:114276069-114276091 CTGGATACATAACGAAATGAAGG - Intergenic
995814525 5:116152097-116152119 CTGGGTACATAACAAAATGAAGG - Intronic
996085112 5:119297346-119297368 CTGGGTACATAACAAAATGAAGG - Intronic
996267379 5:121557828-121557850 CTGGGTACATAACAAAATGAAGG + Intergenic
996301711 5:121995415-121995437 CTGGGTACACAACGAAATGAAGG + Intronic
996335569 5:122380781-122380803 CTGGATACATAACGAAATGAAGG - Intronic
996355855 5:122595773-122595795 CTGGATACATAACGAAATGAAGG - Intergenic
996639744 5:125738100-125738122 CTGGGTACATAACAAAATGAAGG - Intergenic
996697364 5:126413343-126413365 TTGGATAAACAACAAAATTAAGG - Intronic
996751470 5:126893530-126893552 CTGGATACATAACGAAATGAAGG - Intronic
996813063 5:127542114-127542136 CTGGGTACATAACAAAATGAAGG - Intronic
996955995 5:129184327-129184349 CTGGGTACATAACAAAATGAAGG - Intergenic
997042022 5:130267546-130267568 CTGGATACATAACGAAATGAAGG - Intergenic
997134390 5:131310187-131310209 CTGGGTACATAACAAAATGAAGG - Intronic
997783905 5:136688498-136688520 TTGGATTAACAACAAAATTAAGG + Intergenic
997797587 5:136826261-136826283 CTGGGTACATAACAAAATGAAGG - Intergenic
997808577 5:136944682-136944704 CTGGGTACATAACAAAATGAAGG - Intergenic
997819101 5:137047880-137047902 CTGGGTACATAACAAAATGAAGG - Intronic
997920199 5:137971362-137971384 CTGGGTACATAACAAAATGAAGG + Intronic
998694781 5:144627056-144627078 CTGGGTACATAACAAAATGAAGG - Intergenic
998723878 5:144986682-144986704 CTGGGTAAACAACAAAATGAAGG - Intergenic
998740604 5:145196470-145196492 TTGGATACTCTACAAGATCCAGG + Intergenic
998803770 5:145897720-145897742 TTTGGTAAGCAACAAAATCAAGG + Intergenic
999034259 5:148329745-148329767 CTGGGTACATAACAAAATGAAGG - Intronic
999064505 5:148671438-148671460 CTGGGTACATAACAAAATGAAGG - Intronic
999094019 5:148962228-148962250 TTGGAGAAACAACCGAATCAGGG + Intronic
999563935 5:152836785-152836807 TTGGAAACATAAGAAAAACATGG + Intergenic
999603596 5:153293888-153293910 ATGGGTACATAACAAAATGAAGG - Intergenic
999604882 5:153303677-153303699 ATGGGTACATAACAAAATGAAGG - Intergenic
999646885 5:153726141-153726163 CTGGGTACATAACAAAATGAAGG + Intronic
1000271416 5:159687330-159687352 CTGGATACATAACCAAATGAAGG - Intergenic
1000412070 5:160944321-160944343 CTGGGTACATAACAAAATGAAGG - Intergenic
1000424071 5:161070799-161070821 TTGGATAAACAACCAAATTAAGG + Intergenic
1000587634 5:163120079-163120101 CTGGGTACATAACAAAATGAAGG - Intergenic
1000590296 5:163149636-163149658 CTGGATAAATAACAAAATTAAGG + Intergenic
1000746767 5:165043698-165043720 CTGGGTACATAACAAAATGAAGG - Intergenic
1001190092 5:169621788-169621810 CTGGGTACAAAACAAAATGAAGG + Intergenic
1001262435 5:170243018-170243040 CTGGATACATAACGAAATGAAGG - Intronic
1001348577 5:170933654-170933676 CTGGGTACATAACGAAATCAAGG - Intronic
1001983619 5:176054640-176054662 CTGGCTACATAACAAAATGAAGG + Intronic
1001986824 5:176081410-176081432 CTGGCTACATAACAAAATGAAGG - Intronic
1002230046 5:177756737-177756759 CTGGCTACATAACAAAATGAAGG + Intronic
1002233850 5:177789412-177789434 CTGGCTACATAACAAAATGAAGG - Intronic
1002265297 5:178027040-178027062 CTGGCTACATAACAAAATGAAGG - Intronic
1002673828 5:180892601-180892623 CTGGATAAATAACAAAATTAAGG + Intergenic
1002808867 6:605942-605964 CTGGATACATAACAAAATGAAGG - Intronic
1003416609 6:5915096-5915118 CTGGGTACATAACAAAATTAAGG - Intergenic
1003649523 6:7946418-7946440 CTGGGTACATAACAAAATGAAGG - Intronic
1003700555 6:8460086-8460108 TTGGATGAACAATGAAATCAAGG - Intergenic
1004303917 6:14482872-14482894 CTGGGTACATAACAAAATGAAGG + Intergenic
1004717421 6:18231119-18231141 CTGGGTACATAACAAAATGAAGG + Intronic
1004831801 6:19484626-19484648 CTGGGTACATAACAAAATGAAGG + Intergenic
1004872122 6:19916527-19916549 TTGGGTAAACAATGAAATCAAGG + Intergenic
1005177344 6:23061715-23061737 TTGGGTACATAACAAAATGAAGG + Intergenic
1005237057 6:23776788-23776810 CTGGGTACATAACAAAATGAAGG + Intergenic
1005263441 6:24085737-24085759 CTGGGTACATAACAAAATGAAGG + Intergenic
1005362691 6:25046260-25046282 TTGGGCAAACAACAAAATCAAGG + Intergenic
1005373758 6:25161069-25161091 CTGGGTACATAACAAAATGAAGG + Intergenic
1005793755 6:29334674-29334696 TTGGGTAAACAATAAAATTAAGG + Intergenic
1007216011 6:40238457-40238479 TTGGATAAATAATAAAATTAAGG + Intergenic
1007354192 6:41299139-41299161 TTGGATAAGCAACAAAATTAAGG + Intergenic
1007845354 6:44750326-44750348 CTGGGTACATAACAAAATGAAGG + Intergenic
1007954891 6:45908512-45908534 TTGGGTAAACAACAAAATTACGG - Intronic
1008083426 6:47218707-47218729 CTGGGTACATAACAAAATGAAGG + Intergenic
1008193711 6:48492563-48492585 CTGGATACATAACGAAATTAAGG - Intergenic
1008240153 6:49100261-49100283 CTGGGTACATAACAAAATGAAGG + Intergenic
1008671827 6:53776916-53776938 CTGGTTACATAACAAAATGAAGG + Intergenic
1008735472 6:54538541-54538563 TGACATACCCAACAAAATCAAGG + Intergenic
1008796450 6:55309350-55309372 CTGGGTACATAACAAAATGAAGG - Intergenic
1008829304 6:55738415-55738437 CTGGGTACATAACAAAATGAAGG + Intergenic
1008998128 6:57682387-57682409 TTGGGTAAATAACAAAATTAAGG + Intergenic
1009000133 6:57703300-57703322 CTGGGTACATAACAAAATAAAGG + Intergenic
1009166498 6:60347985-60348007 CTGGGTACATAACAAAATGAAGG - Intergenic
1009186623 6:60581755-60581777 TTGGATAAATAACAAAATTAAGG + Intergenic
1009188604 6:60602716-60602738 TTAGGTACATAACAAAATAAAGG + Intergenic
1009210066 6:60851544-60851566 CTGGATAAACATCAAAATTAAGG + Intergenic
1009215867 6:60919334-60919356 TTGGGTACCCAAGAAAAACAGGG + Intergenic
1009233505 6:61094572-61094594 TTGGGTACATAACGAAATGAAGG + Intergenic
1009246937 6:61250299-61250321 CTGGGTACATAACAAAATGAAGG - Intergenic
1009248572 6:61271251-61271273 TTGGGTACATAACGAAATGAAGG + Intergenic
1009299890 6:62003904-62003926 TTGGGTAAATAACAAAATGAAGG + Intronic
1009303839 6:62062529-62062551 CTGGGTACATAACAAAATGAAGG + Intronic
1009323032 6:62314935-62314957 CTGGGTACACAACAAAATGAAGG + Intergenic
1009341157 6:62556473-62556495 CTGGGTACATAACAAAATGAAGG + Intergenic
1009410991 6:63364837-63364859 CTGGGTACATAACAAAATGAAGG + Intergenic
1009519098 6:64659136-64659158 CTGGGTACATAACAAAATGAAGG + Intronic
1009521502 6:64688464-64688486 CTGGGTACATAACAAAATGAAGG - Intronic
1009556622 6:65178962-65178984 CTGGGTACATAACAAAATGAAGG + Intronic
1009587070 6:65620793-65620815 CTGGGTACATAACAAAATGAAGG - Intronic
1009613275 6:65973885-65973907 CTGGGTACATAACAAAATGAAGG + Intergenic
1009695578 6:67098296-67098318 CTGGGTACATAACAAAATGAAGG + Intergenic
1009767082 6:68092113-68092135 ATGGCTACTCAACAGAATCAAGG + Intergenic
1009849490 6:69177674-69177696 TTGGGTAAACAACAAACTTAAGG - Intronic
1009927830 6:70141758-70141780 TGGAAGACACAATAAAATCAAGG - Intronic
1010019536 6:71143100-71143122 CTGGGTACATAACAAAATGAAGG + Intergenic
1010093276 6:72009225-72009247 CTGGATACATAACGAAATGAAGG + Intronic
1010271470 6:73920406-73920428 CTGGGTACATAACAAAATGAAGG + Intergenic
1010275210 6:73961162-73961184 CTGGGTACATAACAAAATGAAGG - Intergenic
1010279738 6:74010410-74010432 CTGGGTACATAACAAAATGAAGG - Intergenic
1010411313 6:75565225-75565247 TTGGATAAACAACAAAACTAAGG + Intergenic
1010441730 6:75902966-75902988 CTGGGTACATAACAAAATGAAGG - Intronic
1010526198 6:76903446-76903468 CTGGATACATAACGAAATGAAGG - Intergenic
1010544015 6:77127301-77127323 TTGGATAGACAACAAAATTAAGG + Intergenic
1010553769 6:77254406-77254428 CTGGGTACATAACAAAATGAAGG + Intergenic
1010593128 6:77733868-77733890 CTGGGTACATAACAAAATGAAGG - Intronic
1010599083 6:77801715-77801737 CTGGGTACACAACAAAATGAAGG - Intronic
1010782227 6:79956998-79957020 CTGGGTACATAACAAAATGAAGG - Intergenic
1010823028 6:80438086-80438108 TTGGATACTGAAGAAAATGAAGG + Intergenic
1010887059 6:81256862-81256884 CTGGATAAATAACAAAATGAAGG + Intergenic
1010920697 6:81676655-81676677 TTGGGTAAACAATAAAATTAAGG + Intronic
1010959318 6:82127426-82127448 CTGGGTACATAACAAAATGAAGG - Intergenic
1010983153 6:82392657-82392679 CTGGATACATAACGAAATGAAGG - Intergenic
1011006223 6:82648241-82648263 CTGGGTAGACAACAAAATTAAGG + Intergenic
1011024607 6:82853824-82853846 CTGGGTACATAACAAAATGAAGG + Intergenic
1011093704 6:83634879-83634901 TTGGGTAAACAACAAAATTAAGG - Intronic
1011244251 6:85305455-85305477 TTGGATAAATAACGAAATGAAGG - Intergenic
1011288882 6:85754532-85754554 CTGGGTACATAACAAAATGAAGG + Intergenic
1011289377 6:85760550-85760572 CTGGGTACATAACAAAATGAGGG - Intergenic
1011298673 6:85851127-85851149 CTGGGTACATAACAAAATGAAGG - Intergenic
1011348306 6:86395468-86395490 CTGGGTACATAACAAAATGAAGG + Intergenic
1011846092 6:91564627-91564649 TTGGATAAACAATGAAATTAAGG + Intergenic
1011924675 6:92627241-92627263 CTGGGTACACAACAAAATGAAGG + Intergenic
1011926731 6:92654385-92654407 TTGGGTACATAACAAAATGAAGG - Intergenic
1011950118 6:92954755-92954777 CTGGGTACATAACAAAATGAAGG + Intergenic
1011999367 6:93634823-93634845 CTAGATACATAACAAAATGAAGG - Intergenic
1012204109 6:96439503-96439525 CTGGGTACATAACAAAATGAAGG + Intergenic
1012207113 6:96475320-96475342 CTGGGTACATAACAAAATGAAGG - Intergenic
1012336315 6:98062671-98062693 GTGGCTACATAACAAAATGAAGG - Intergenic
1012363498 6:98411392-98411414 CTGGATAAATAACAAAATTAAGG - Intergenic
1012481644 6:99674032-99674054 CTGGGTACATAACAAAATGAAGG - Intergenic
1012508139 6:99972802-99972824 CTGGGTACATAACAAAATGAAGG - Intronic
1012598248 6:101064897-101064919 CTGGGTAAACAACAAAATGAAGG + Intergenic
1012878297 6:104755681-104755703 TTGGGTAAACAACAAAATTATGG + Intronic
1013255023 6:108376504-108376526 TGGGGTAAACAATAAAATCAAGG - Intronic
1013258506 6:108413669-108413691 CTGGGTACATAACAAAATGAAGG + Intronic
1013267653 6:108515401-108515423 CTGGGTACATAACAAAATGAAGG + Intronic
1013344641 6:109248464-109248486 CTGGATACATAACAAAATGAAGG - Intergenic
1013470943 6:110464047-110464069 TTGGGTAAACCATAAAATCAAGG + Intronic
1013704459 6:112815786-112815808 CTGGATACATAACGAAATGAAGG + Intergenic
1013736145 6:113229252-113229274 CTGGGTACATAACAAAATGAAGG + Intergenic
1013785631 6:113776757-113776779 TTCTATACATAACAAAATCAAGG - Intergenic
1013868166 6:114723965-114723987 CTGGGTACATAACAAAATGAAGG - Intergenic
1013886425 6:114973605-114973627 CTGGGTACATAACAAAATGAAGG - Intergenic
1013902800 6:115177991-115178013 CTGGATACATAACGAAATGAAGG + Intergenic
1014063343 6:117098511-117098533 CTGGGTACATAACAAAATGAAGG - Intergenic
1014071317 6:117184582-117184604 CTGGGTACATAACAAAATGAAGG + Intergenic
1014330445 6:120057062-120057084 TTAGGTAAACAACAAAATTAAGG + Intergenic
1014424544 6:121287903-121287925 CTGGGTACATAACAAAATGAAGG + Intronic
1014525658 6:122498478-122498500 TTGGGTAAACAACAAAAATAAGG + Intronic
1014565396 6:122942643-122942665 TTGGGTACATAACGAAATGAAGG - Intergenic
1014650574 6:124031650-124031672 CTGGGTACATAACAAAATGAAGG - Intronic
1014702699 6:124710071-124710093 CTGGGTACATAACAAAATGAAGG - Intronic
1014748798 6:125231643-125231665 TTGTTTATACGACAAAATCATGG + Intronic
1014850013 6:126329492-126329514 CTGGGTACATAACAAAATGAAGG + Intergenic
1014881489 6:126729142-126729164 CTGGGTACATAACAAAATGAAGG + Intergenic
1014892947 6:126864766-126864788 CTGGGTACATAACAAAATGAAGG - Intergenic
1014907381 6:127046147-127046169 CTGGGTACATAACAAAATGAAGG + Intergenic
1015007186 6:128297626-128297648 CTGGGTACATAACAAAATGAAGG + Intronic
1015133291 6:129838336-129838358 CTGGGTACATAACAAAATGAAGG + Intronic
1015779477 6:136849593-136849615 CTGGATACATAACGAAATGAAGG - Intronic
1015882995 6:137888608-137888630 CTGGATAAATAACAAAATTAAGG - Intergenic
1016009481 6:139124294-139124316 CTGGGTACATAACAAAATGAAGG - Intergenic
1016205586 6:141464670-141464692 TAGTTTACACAACAAGATCAAGG + Intergenic
1016240105 6:141919615-141919637 CTGGATACATAACGAAATGAAGG + Intergenic
1016333630 6:142980603-142980625 CTGGATACATAACAAAATGAAGG - Intergenic
1016364878 6:143305465-143305487 CTGGGTACATAACAAAATGAAGG - Intronic
1016552833 6:145300821-145300843 CTGGGTACACAACGAAATGAAGG - Intergenic
1017064424 6:150516366-150516388 CTGGAAACACAACAGAATGACGG + Intergenic
1017305399 6:152912557-152912579 TTGGATAGACAATGAAATAAAGG - Intergenic
1017653818 6:156607581-156607603 CTGGGTACATAACAAAATGAAGG + Intergenic
1018011406 6:159673498-159673520 CTGGGTACATAACAAAATGAAGG + Exonic
1018125977 6:160682963-160682985 CTGGGTACATAACAAAATGAAGG - Intergenic
1018175543 6:161175877-161175899 CTGGGTACATAACAAAATGAAGG - Intronic
1018339997 6:162841836-162841858 CTGGATACATAACGAAATGAAGG - Intronic
1018532742 6:164785200-164785222 CTGGGTACATAACAAAATGAAGG - Intergenic
1018789674 6:167137707-167137729 TTGGTTACAGCACAAAATGATGG + Exonic
1020487386 7:8736369-8736391 CTGGGTACATAACAAAATGAAGG - Intronic
1020533717 7:9367163-9367185 TTGCATAAACAACAAAATGAAGG + Intergenic
1020607134 7:10353708-10353730 TTGGGTAAACAATATAATCAAGG - Intergenic
1020922447 7:14281762-14281784 TTGGGTACATAACGAAATGAAGG + Intronic
1020925226 7:14316034-14316056 TTGGGTACATAACGAAATGAAGG + Intronic
1021017250 7:15550067-15550089 CTGGATACATAACGAAATGAAGG + Intronic
1021069529 7:16219193-16219215 CTGGATACATAACGAAATGAAGG + Intronic
1021082520 7:16381231-16381253 CTGGATACATAACGAAATGAAGG - Intronic
1021201998 7:17737584-17737606 CTGGGTACACAACGAAATGAAGG + Intergenic
1021319425 7:19192288-19192310 CTGGATACATAACGAAATGAAGG - Intergenic
1021319754 7:19195174-19195196 CTGGGTACATAACAAAATGAAGG - Intergenic
1021320399 7:19203179-19203201 TTGGATCCACAACAAACACATGG + Intergenic
1021431870 7:20569227-20569249 CTGGGTACATAACAAAATGAAGG + Intergenic
1021661877 7:22927083-22927105 CTGGATACATAACGAAATGAAGG + Intergenic
1021662883 7:22938432-22938454 TCTGACACACAACCAAATCAAGG + Intergenic
1021866669 7:24965178-24965200 TTTGAGACAAAACAAAATTAGGG - Intronic
1022079479 7:27005684-27005706 CTGGGTACATAACAAAATGAAGG - Intergenic
1022142521 7:27505417-27505439 CTGGATACATAACAAAATGAAGG - Intergenic
1022187542 7:27984854-27984876 CTGGGTACACAACAAAATGAAGG + Intronic
1022352933 7:29582697-29582719 CTGGATACATAACGAAATGAAGG + Intergenic
1022439049 7:30417718-30417740 CTGGATACACAACGAAATGAAGG - Intergenic
1022453849 7:30540368-30540390 CTGGATACACAACGAAATGAAGG + Intronic
1022578580 7:31524112-31524134 TTGGATACTCACCAATATCAGGG - Intronic
1022775655 7:33524989-33525011 CTGGATACATAACAAAATGAAGG - Intronic
1022854016 7:34297865-34297887 TTGGAATCAGAACACAATCAAGG + Intergenic
1022994646 7:35742435-35742457 CTGGGTACATAACAAAATGAAGG - Intergenic
1023245987 7:38204386-38204408 CTGGGTACATAACAAAATGAAGG + Intronic
1023380672 7:39604438-39604460 GTCGATACCTAACAAAATCAGGG + Intronic
1023419554 7:39964864-39964886 CTGGATACATAACGAAATGAAGG - Intronic
1024091919 7:45950640-45950662 CTGGGTACATAACAAAATGAAGG - Intergenic
1024416805 7:49117210-49117232 CTGGGTACATAACAAAATGAAGG - Intergenic
1024916108 7:54501974-54501996 CTGGGTACATAACAAAATGAAGG - Intergenic
1025146479 7:56509653-56509675 CTGGATACATAACGAAATGAAGG - Intergenic
1025183883 7:56841626-56841648 CTGGGTACATAACAAAATGAAGG - Intergenic
1025501901 7:61311204-61311226 CTGGGTACATAACAAAATGAAGG - Intergenic
1025516766 7:61657426-61657448 CTGGGTACATAACAAAATGAAGG - Intergenic
1025541104 7:62086250-62086272 CTGGGTACATAACAAAATGAAGG - Intergenic
1025552566 7:62268971-62268993 CTGGGTACATAACAAAATGAAGG - Intergenic
1025609264 7:63062987-63063009 CTGGATACACAACGAAATGAAGG + Intergenic
1025688042 7:63735342-63735364 CTGGGTACATAACAAAATGAAGG + Intergenic
1025737420 7:64163391-64163413 CTGGGTACATAACAAAATGAAGG + Intronic
1025856845 7:65288124-65288146 TTGGATAAAGAACATAATTAAGG - Intergenic
1025874469 7:65467732-65467754 CTGGGTACATAACAAAATGAAGG - Intergenic
1026497537 7:70916314-70916336 TTGAAAACACAATAACATCAAGG - Intergenic
1027276655 7:76564435-76564457 CTGGGTACATAACAAAATGAAGG - Intergenic
1027667167 7:81054447-81054469 TTGGGTACATAACAAAATGAAGG + Intergenic
1027697063 7:81424767-81424789 CTGGATACATAACGAAATGAAGG - Intergenic
1027921968 7:84405799-84405821 CTGGGTACATAACAAAATGAAGG + Intronic
1027923193 7:84422755-84422777 CTGGGTACATAACAAAATGAAGG - Intronic
1028065483 7:86378244-86378266 GTGGGTACACAACAAAATGAAGG + Intergenic
1028200268 7:87953382-87953404 CTGGATACATAACGAAATGAAGG - Intronic
1028436431 7:90809372-90809394 CTGGGTACATAACAAAATGAAGG + Intronic
1028451586 7:90991249-90991271 ACTCATACACAACAAAATCAGGG + Intronic
1028523918 7:91761959-91761981 CTGGGTACATAACAAAATGAAGG + Intronic
1028532677 7:91855042-91855064 TTGGGTAAACAACTAAATTAAGG + Intronic
1028597457 7:92560586-92560608 TTGAATACACAGAAAATTCAAGG - Intergenic
1028644731 7:93082672-93082694 TTGGGAAGACAACAAAATTAAGG + Intergenic
1028946184 7:96583212-96583234 CTGGATACATAACGAAATGAAGG - Intronic
1029059355 7:97780776-97780798 CTGGGTACATAACAAAATGAAGG + Intergenic
1029313437 7:99688918-99688940 CTGGCTACATAACAAAATGAAGG + Intronic
1029965212 7:104732964-104732986 TGGGGTACATAACAAAATGAAGG - Intronic
1030132348 7:106212849-106212871 CTGGGTACATAACAAAATGAAGG + Intergenic
1030142800 7:106322269-106322291 CTGGGTACATAACAAAATGAAGG + Intergenic
1030146071 7:106357374-106357396 TTGGATACACAACAGCAACTTGG + Intergenic
1030166162 7:106557692-106557714 CTGGGTACATAACAAAATGAAGG - Intergenic
1030178000 7:106674623-106674645 CTGGATACATAACGAAATGAAGG + Intergenic
1030458040 7:109797870-109797892 CTGGGTACATAACAAAATGAAGG + Intergenic
1030534316 7:110746653-110746675 CTGGGTACATAACAAAATGAAGG + Intronic
1030736263 7:113052308-113052330 CTGGGTACATAACAAAATGAAGG - Intergenic
1030793416 7:113757566-113757588 CTGGGTACATAACGAAATCAAGG + Intergenic
1030970561 7:116049880-116049902 CTGGGTACACAACGAAATGAAGG + Intronic
1031029714 7:116721725-116721747 CTGGATACATAACGAAATGAAGG - Intronic
1031242853 7:119268110-119268132 TTGGGTAAACCACAAAATTAAGG - Intergenic
1031285167 7:119857689-119857711 CTGGCTACATAACAAAATGAAGG + Intergenic
1031407512 7:121404401-121404423 GTGGATACACAACCAACACAGGG + Intergenic
1031585230 7:123525942-123525964 CTGGGTACATAACAAAATGAAGG - Intronic
1031591001 7:123592525-123592547 CTGGGTACATAACAAAATGAAGG - Intronic
1031699305 7:124903425-124903447 CTGGGTACATAACAAAATGAAGG + Intronic
1031706099 7:124982703-124982725 CTGGGTACATAACAAAATGAAGG - Intergenic
1032289962 7:130580246-130580268 CTGGATACATAACGAAATGAAGG + Intronic
1032445708 7:131981580-131981602 CTGGGTACATAACAAAATGAAGG - Intergenic
1032603424 7:133324451-133324473 CTGGGTACATAACAAAATGAAGG - Intronic
1032881683 7:136097442-136097464 CTGGATACATAACGAAATGAAGG - Intergenic
1032939972 7:136777999-136778021 CTGGATACATAACGAAATGAAGG - Intergenic
1033102656 7:138488588-138488610 CTGGGTACATAACAAAATGAAGG - Intronic
1033106820 7:138534454-138534476 CTGGGTACATAACAAAATGAAGG - Intronic
1033198761 7:139350440-139350462 ATGGATACATAACAACAACATGG - Intronic
1033565316 7:142572701-142572723 TTGGATAAATAACAAAATTAAGG + Intergenic
1033626410 7:143114197-143114219 TTGGGTAAATAACAAAATGAAGG + Intergenic
1033856168 7:145563666-145563688 CTGGGTACACAACAAAATGAAGG + Intergenic
1033862178 7:145641979-145642001 TTGAGTAAACAACAAAATTAAGG - Intergenic
1034236677 7:149577044-149577066 CTGGGTACATAACAAAATGAAGG - Intergenic
1034368974 7:150577715-150577737 CTGGGTACATAACAAAATGAAGG - Intergenic
1034371340 7:150599974-150599996 CTGGGTACATAACGAAATCAAGG + Intergenic
1034379806 7:150681301-150681323 CTGGGTACATAACAAAATGAAGG + Intergenic
1034703636 7:153120269-153120291 CTGGGTACATAACAAAATGAAGG - Intergenic
1034714826 7:153232245-153232267 TTGGGTAAATAACAAAATTAAGG - Intergenic
1035008532 7:155689713-155689735 CTGGGTACATAACAAAATGAAGG - Intronic
1035493571 7:159301264-159301286 TTGCATACATAACGAAATGAAGG + Intergenic
1036050406 8:5189901-5189923 TTGGGTACATAACGAAATGAAGG + Intergenic
1036196189 8:6717135-6717157 TTTGATTCACAACTAAACCAAGG - Intronic
1036209471 8:6830801-6830823 TTATATACACCAGAAAATCATGG + Intronic
1036689541 8:10935640-10935662 CTGGGTACATAACAAAATGAAGG - Intronic
1037144749 8:15559243-15559265 CTGGGTACATAACAAAATGAAGG - Intronic
1037146516 8:15579557-15579579 CTGGGTACATAACAAAATGAAGG - Intronic
1037775012 8:21828480-21828502 CTGGGTACATAACAAAATGAAGG + Intergenic
1037999238 8:23377180-23377202 CTGGGTACATAACAAAATGAAGG - Intronic
1038225959 8:25658181-25658203 CTGGGTACATAACAAAATGAAGG - Intergenic
1038859639 8:31373373-31373395 TTGGGTAAACAATAAAATTAAGG - Intergenic
1038872582 8:31511659-31511681 TGGGGTAAACAACAAAATAAAGG - Intergenic
1039077131 8:33701443-33701465 CTGGGTACATAACAAAATGAAGG - Intergenic
1039127329 8:34217821-34217843 CTGGGTACATAACAAAATGAAGG + Intergenic
1039207600 8:35174722-35174744 CTGGATACATAACGAAATGAAGG - Intergenic
1039639369 8:39202872-39202894 CTGGGTACATAACAAAATGAAGG - Intronic
1039825745 8:41172751-41172773 TTGGCTACACAAGAGTATCAAGG - Intergenic
1039849855 8:41355184-41355206 TTGGATACATAATGAAATGAAGG - Intergenic
1040094071 8:43426610-43426632 CTGGGTACATAACAAAATGAAGG + Intergenic
1040373522 8:46800211-46800233 CTGGGTACATAACAAAATGAAGG + Intergenic
1040390397 8:46945047-46945069 TTGGGTACATAACGAAATGAAGG + Intergenic
1040398390 8:47021491-47021513 CTGGGTACATAACAAAATGAAGG + Intergenic
1040405513 8:47098207-47098229 CTGGATACATAACGAAATCAAGG - Intergenic
1040411717 8:47161004-47161026 CTGGGTACATAACAAAATGAAGG + Intergenic
1040591504 8:48797151-48797173 CTGGATACATAACGAAATGAAGG - Intergenic
1040612261 8:48997112-48997134 CTGGATACATAACGAAATGAAGG - Intergenic
1040814710 8:51495181-51495203 CTGGGTACATAACAAAATGAAGG + Intronic
1040908522 8:52493946-52493968 TTTCATACACATCCAAATCAGGG - Intergenic
1040962185 8:53046401-53046423 CTGGGTACATAACAAAATGAAGG - Intergenic
1041204046 8:55479300-55479322 CTGGGTACATAACAAAATGAAGG + Intronic
1041221225 8:55653403-55653425 CTGGGTACATAACAAAATGAAGG - Intergenic
1041385217 8:57294160-57294182 CTGGGTACACAACGAAATGAAGG - Intergenic
1041427253 8:57736378-57736400 TTGGATAAACAATGAAATTAAGG - Intergenic
1041445372 8:57945985-57946007 TTGGATAAACAATGAAATTAAGG - Intergenic
1041447964 8:57974357-57974379 TGAGCCACACAACAAAATCAAGG + Intergenic
1041478319 8:58290199-58290221 CTGGGTACATAACAAAATGAAGG - Intergenic
1041584778 8:59502978-59503000 TTGGGTAAACAATAAAATTAAGG + Intergenic
1041630291 8:60080135-60080157 CTGGATAAATAACAAAATTAAGG - Intergenic
1041640433 8:60194109-60194131 TTGCATTCACAAAAAAAACAGGG - Intronic
1041744292 8:61190274-61190296 CTGGATACATAACAAAATGAAGG + Intronic
1041949707 8:63487550-63487572 CTGGGTACATAACAAAATGAAGG - Intergenic
1041974124 8:63777424-63777446 CTGGGTACATAACGAAATCAAGG - Intergenic
1041997958 8:64086554-64086576 CTGGGTACATAACAAAATGAAGG + Intergenic
1042010831 8:64242860-64242882 CTGGGTACATAACAAAATGAAGG + Intergenic
1042019718 8:64358666-64358688 TTGTATACAAAAGAAAATTAAGG + Intergenic
1042171482 8:65996017-65996039 CTGGGTACATAACAAAATGAAGG - Intergenic
1042270620 8:66952335-66952357 CTGGATACATAACGAAATGAAGG - Intronic
1042362384 8:67897151-67897173 CTGGGTACATAACAAAATGAAGG + Intergenic
1042394775 8:68279181-68279203 CTGGGTACATAACAAAATGAAGG + Intergenic
1042410751 8:68462692-68462714 CTGGGTACATAACAAAATGAAGG + Intronic
1042634348 8:70856874-70856896 CTGGGTACATAACAAAATGAAGG + Intergenic
1042720631 8:71823144-71823166 CTGGGTACATAACAAAATGAAGG + Intergenic
1042764524 8:72306313-72306335 TTGGGTAAACAATAAAATTAAGG - Intergenic
1043034799 8:75182950-75182972 TTGGATAAACAATAAAATTAAGG + Intergenic
1043088932 8:75873617-75873639 CTGGGTAAACAACAAAATGAAGG - Intergenic
1043177874 8:77044746-77044768 CTGGGTACATAACAAAATTAAGG + Intergenic
1043200740 8:77366401-77366423 CTGGGTACATAACAAAATGAAGG + Intergenic
1043238590 8:77901309-77901331 TTGATTACAAAAAAAAATCAGGG - Intergenic
1043342620 8:79258792-79258814 CTGGGTACATAACAAAATGAAGG + Intergenic
1043555905 8:81429971-81429993 CTGGGTACATAACAAAATGAAGG + Intergenic
1043617643 8:82146611-82146633 CTGGGTACATAACAAAATGAAGG - Intergenic
1043652372 8:82612492-82612514 TTGGATGAACAACAAAATTAAGG - Intergenic
1043697140 8:83233809-83233831 CTGGGTACATAACAAAATGAAGG + Intergenic
1043806908 8:84683082-84683104 CTGGGTACATAACAAAATGAAGG - Intronic
1044156768 8:88857870-88857892 CTGGGTACACAACGAAATGAAGG - Intergenic
1044172283 8:89069746-89069768 TTGGGTAAAAAACAAAATTAAGG - Intergenic
1044175319 8:89113410-89113432 TAGAATAGACAACAAAACCATGG + Intergenic
1044207952 8:89513214-89513236 CTGGATACATAACGAAATGAAGG + Intergenic
1044209909 8:89537998-89538020 CTGGATACATAACAAAATGAAGG + Intergenic
1044353597 8:91195084-91195106 CTGGGTACATAACAAAATGAAGG - Intronic
1044402679 8:91790666-91790688 CTGGATACATAACGAAATGAAGG + Intergenic
1044440572 8:92219306-92219328 TTGGTTACACAACCAAATGAAGG - Intergenic
1044548533 8:93486126-93486148 CTGGGTACATAACAAAATGAAGG + Intergenic
1044746120 8:95372947-95372969 CTGGGTACATAACAAAATGAAGG - Intergenic
1044767400 8:95591256-95591278 CTGGATACATAACAAAATGAAGG - Intergenic
1044904105 8:96981070-96981092 TGAGATACAGAAAAAAATCAAGG + Intronic
1044955829 8:97478859-97478881 TTGGATAAATAATGAAATCATGG + Intergenic
1044968053 8:97592815-97592837 CTGGGTACATAACAAAATGAAGG - Intergenic
1045086992 8:98697598-98697620 CTGGGTACATAACAAAATGAAGG - Intronic
1045125485 8:99084694-99084716 CTGGCTACATAACAAAATGAAGG - Intronic
1045241360 8:100404695-100404717 CTGGGTACATAACAAAATGAAGG + Intronic
1045360540 8:101428637-101428659 CTGGGTACATAACAAAATGAAGG + Intergenic
1045764495 8:105650617-105650639 CTGGGTACATAACAAAATGAAGG - Intronic
1045785970 8:105920721-105920743 TTGGATAAACAACAAAATTAAGG + Intergenic
1045954702 8:107893122-107893144 CTGGGTACATAACAAAATGAAGG - Intergenic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1046218644 8:111182924-111182946 CTGGATACAGAACAAAATGAAGG - Intergenic
1046251124 8:111633003-111633025 CTGGGTACATAACAAAATGAAGG + Intergenic
1046393695 8:113611000-113611022 CTGGATACATAACAAAATGAAGG + Intronic
1046415619 8:113909547-113909569 CTGGATACATAACGAAATGAAGG - Intergenic
1046605795 8:116370755-116370777 TTGGATAAACAAAGAAATTAAGG - Intergenic
1046633690 8:116647689-116647711 TTGGATTCCTAAGAAAATCAAGG + Intronic
1046777705 8:118181253-118181275 TTGGATTCACAATAACATCTTGG + Intergenic
1046828747 8:118720958-118720980 CTGGGTACATAACAAAATGAAGG - Intergenic
1046873904 8:119233073-119233095 TTGGGTACATAACAAAATGAAGG + Intronic
1046972244 8:120235857-120235879 CTGGGTACATAACAAAATCAAGG - Intronic
1047043654 8:121026941-121026963 CTGGGTACATAACAAAATGAAGG + Intergenic
1047069898 8:121332020-121332042 TTGGGTACATAACGAAATGAAGG - Intergenic
1047156925 8:122329908-122329930 CTGGATACATAACGAAATGAAGG - Intergenic
1047159327 8:122359617-122359639 TTGGGTAAACAACGAAATTAAGG - Intergenic
1047639452 8:126802860-126802882 CTGGATACATAACGAAATGAAGG - Intergenic
1047656540 8:126983677-126983699 CTGGATACATAACGAAATGAAGG - Intergenic
1047686930 8:127314344-127314366 CTGGATACATAACGAAATGAAGG + Intergenic
1047841933 8:128762745-128762767 CTGGGTACATAACAAAATGAAGG + Intergenic
1047892364 8:129326539-129326561 CTGGGTACATAACAAAATGAAGG + Intergenic
1047931809 8:129735557-129735579 CTGGGTAAACAACAAAATGAAGG + Intergenic
1047939261 8:129812954-129812976 TTGGGTAAACAACAAAATTAGGG - Intergenic
1048520988 8:135154844-135154866 CTGGGTACATAACAAAATGAAGG - Intergenic
1048532414 8:135261866-135261888 CTGGGTACATAACAAAATGAAGG + Intergenic
1048540570 8:135338275-135338297 CTGGGTACATAACAAAATGAAGG + Intergenic
1048858711 8:138706538-138706560 CTGGCTACATAACAAAATGAAGG + Intronic
1049150045 8:141029272-141029294 TTAAATACAGAACAAAATCTTGG - Intergenic
1050007348 9:1146792-1146814 CTGGGTACATAACAAAATGAAGG + Intergenic
1050011868 9:1193362-1193384 CTGGGTACATAACAAAATGAAGG - Intergenic
1050082935 9:1934314-1934336 CTGGGTACATAACAAAATGAAGG - Intergenic
1050178622 9:2896241-2896263 CTGGATACATAACGAAATGAAGG - Intergenic
1050232334 9:3539987-3540009 CTGGATACATAACGAAATGAAGG - Intergenic
1050421951 9:5475053-5475075 CTGGGTACATAACAAAATGAAGG - Intergenic
1050497621 9:6261255-6261277 CTGGGTACATAACAAAATGAAGG - Intergenic
1050509507 9:6379157-6379179 TTGGGTACATAACAAAATAAAGG + Intergenic
1050753116 9:8964790-8964812 TTGGATAAACAATGAAATCAAGG - Intronic
1050840097 9:10137793-10137815 TTTGGTAAACAACAAAATTAAGG + Intronic
1050901040 9:10949392-10949414 CTGGATACATAACGAAATGAAGG + Intergenic
1050956544 9:11668499-11668521 CTGGGTACATAACAAAATGAAGG - Intergenic
1051300682 9:15647152-15647174 CTGGGTACATAACAAAATGAAGG + Intronic
1051315049 9:15820091-15820113 CTGGGTACATAACAAAATGAAGG + Intronic
1051703094 9:19845827-19845849 TTGGATAAACAGCAAAATTAAGG - Intergenic
1051777830 9:20656017-20656039 CTGGGTACATAACAAAATGAAGG - Intergenic
1051829834 9:21263566-21263588 TAATATACACAACATAATCATGG + Intergenic
1051891626 9:21948211-21948233 TTGGGTAAACAACAAAATTAAGG + Intronic
1051905754 9:22093064-22093086 CTGGGTACATAACAAAATGAAGG - Intergenic
1051905986 9:22095332-22095354 CTGGGTACATAACAAAATGAAGG - Intergenic
1052086996 9:24280250-24280272 CTGGGTACATAACAAAATGAAGG + Intergenic
1052132116 9:24860687-24860709 TTGGGTATATAACAAAATGAAGG + Intergenic
1052513728 9:29453471-29453493 TTGGGTACATAACGAAATGAAGG + Intergenic
1052515051 9:29469986-29470008 TTGGATAAACAATGAAATTAAGG - Intergenic
1052540080 9:29799768-29799790 CTGGAAACACAGCAAGATCATGG + Intergenic
1052694352 9:31856678-31856700 TTGGGTAAACAATAAAATTAAGG + Intergenic
1052696562 9:31886399-31886421 CTGGGTACATAACAAAATGAAGG - Intergenic
1052714740 9:32101374-32101396 CTGGGTACATAACAAAATGAAGG + Intergenic
1052814281 9:33088323-33088345 CTGGGTACATAACAAAATGAAGG + Intergenic
1052888247 9:33670233-33670255 CTGGGTAAACAACAAAATGAAGG + Intergenic
1053050395 9:34957298-34957320 TTGAATGCACAAGAAAATAAAGG + Intergenic
1053083962 9:35202078-35202100 CTGGATGCATAACAAAATGAAGG - Intronic
1053583179 9:39428221-39428243 CTGGGTACATAACAAAATGAAGG + Intergenic
1053780754 9:41604515-41604537 TTGTGTAAACAATAAAATCAAGG + Intergenic
1053834273 9:42117426-42117448 CTGGGTACATAACAAAATGAAGG + Intronic
1053847364 9:42253080-42253102 CTGGGTACATAACAAAATGAAGG + Intergenic
1054104760 9:60986964-60986986 CTGGGTACATAACAAAATGAAGG + Intergenic
1054168698 9:61814672-61814694 TTGTGTAAACAATAAAATCAAGG + Intergenic
1054425687 9:65064751-65064773 CTGGATACATAACGAAATGAAGG + Intergenic
1054596273 9:67069983-67070005 CTGGGTACATAACAAAATGAAGG - Intergenic
1054668833 9:67766139-67766161 TTGTGTAAACAATAAAATCAAGG - Intergenic
1054816449 9:69479873-69479895 CTGGATACATAACGAAATGAAGG + Intronic
1054819649 9:69508820-69508842 CTGGATACATAACGAAATGAAGG + Intronic
1054887005 9:70209875-70209897 TTGGGTACATAACGAAATGAAGG - Intronic
1054997624 9:71410009-71410031 CTGGGTACATAACAAAATTAAGG + Intronic
1055260447 9:74427038-74427060 CTGGATACATAACGAAATGAAGG + Intergenic
1055345299 9:75329355-75329377 TTGGGTAAACAACAGAATTAAGG + Intergenic
1055556698 9:77481289-77481311 CTGGATACATAACAAAATGAAGG - Intronic
1055622029 9:78136042-78136064 TTGGGTACATAACGAAATGAAGG + Intergenic
1055710485 9:79055552-79055574 TTGGAAACAGCACAAAAACATGG + Intergenic
1055853265 9:80657358-80657380 CTGGATACATAACGAAATGAAGG - Intergenic
1055990342 9:82099226-82099248 TTGGGTAAACAACAAAATTAAGG - Intergenic
1056029679 9:82539867-82539889 TTGGATTCACAACAATCCCAGGG - Intergenic
1056229968 9:84533378-84533400 CTGGGTACATAACAAAATGAAGG - Intergenic
1056439759 9:86609275-86609297 CTGGGTACATAACAAAATGAAGG - Intergenic
1057086695 9:92217174-92217196 ATGGGTACATAACAAAATGAAGG + Intronic
1057322533 9:94028274-94028296 TTGGATAGAGAGCACAATCAAGG - Intergenic
1057324433 9:94048445-94048467 CTGGGTACATAACAAAATGAAGG - Intronic
1058036272 9:100256656-100256678 CTGGGTACATAACAAAATGAAGG - Intronic
1058192730 9:101938649-101938671 CTGGGTACATAACAAAATGAAGG - Intergenic
1058202729 9:102064418-102064440 CTGGATAAATAACAAAATGAAGG - Intergenic
1058207779 9:102130065-102130087 CTGGGTACATAACAAAATGAAGG - Intergenic
1058441677 9:105014070-105014092 TTGAGTAAACAACAAAATCAAGG - Intergenic
1058490367 9:105492740-105492762 CTGGGTACATAACAAAATGACGG - Intronic
1058496701 9:105566050-105566072 CTGGGTACATAACAAAATGAAGG + Intronic
1058516362 9:105780295-105780317 CTGGATACATAACAAGATGAAGG - Intergenic
1058749927 9:108029828-108029850 TTGGGTACATAACGAAATGAAGG - Intergenic
1058962277 9:110003272-110003294 CTGGGTACATAACAAAATGAAGG - Intronic
1059603041 9:115802275-115802297 CTGGATACATAACGAAATGAAGG - Intergenic
1060133680 9:121130872-121130894 CTGGATACACAATGAAATGAAGG - Intronic
1060334943 9:122712699-122712721 CTGGGTACATAACAAAATGAAGG + Intergenic
1060339615 9:122762730-122762752 CTGGATACAAAACGAAATGAAGG + Intergenic
1061833548 9:133312777-133312799 CTGGGTACATAACAAAATGAAGG + Intergenic
1062369351 9:136229582-136229604 CTGCACACACAACAGAATCACGG + Intronic
1203428453 Un_GL000195v1:65055-65077 TTGGATAAACAAAAAAATTAAGG + Intergenic
1203437819 Un_GL000195v1:158191-158213 TTGGGTAAACAACAAAATTGAGG - Intergenic
1203690979 Un_GL000214v1:42736-42758 CTGGGTACATAACAAAATGAAGG - Intergenic
1203447214 Un_GL000219v1:68603-68625 CTGGGTACATAACAAAATGAAGG - Intergenic
1203378670 Un_KI270435v1:6428-6450 TAGGGTACATAACAAAATGAAGG - Intergenic
1203394486 Un_KI270512v1:12671-12693 CTGGGTACACAACAAAACGAAGG - Intergenic
1203399746 Un_KI270519v1:75625-75647 CTGGGTACATAACAAAATGAAGG + Intergenic
1203511809 Un_KI270741v1:126634-126656 TTGGGTACATAACGAAATGAAGG - Intergenic
1203617947 Un_KI270749v1:86620-86642 CTGGGTACATAACAAAATGAAGG + Intergenic
1203645316 Un_KI270751v1:61455-61477 CTGGGTACATAACAAAATGAAGG + Intergenic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1186142181 X:6587259-6587281 CTGGATACATAACGAAATGAAGG - Intergenic
1186702783 X:12109324-12109346 CTGGGTACATAACAAAATGAAGG + Intergenic
1186708415 X:12167293-12167315 CTGGGTACATAACAAAATGAAGG - Intronic
1186736820 X:12474211-12474233 CTGGGTACATAACAAAATGAAGG + Intronic
1186743381 X:12540990-12541012 CTGGATACATAACAAAATGAAGG + Intronic
1186772983 X:12836270-12836292 CTGGATAAATAACAAAATTAAGG - Intergenic
1186914338 X:14203931-14203953 CTGGGTACATAACAAAATGAAGG - Intergenic
1186931291 X:14393718-14393740 CTGGGTACATAACAAAATGAAGG + Intergenic
1186968303 X:14812065-14812087 CTGGGTACATAACAAAATGAAGG + Intergenic
1187214093 X:17258202-17258224 TTGGAAACTGAACAAATTCATGG + Intergenic
1187248099 X:17571906-17571928 CTGGGTACATAACGAAATCAAGG - Intronic
1187271528 X:17784612-17784634 CTGGGTACATAACAAAATGAAGG - Intergenic
1187548410 X:20276459-20276481 CTGGGTACATAACAAAATTAAGG + Intergenic
1187624888 X:21099870-21099892 CTGGGTACACAACGAAATGAAGG - Intergenic
1187728771 X:22232009-22232031 CTGGGTACATAACAAAATGAAGG - Intronic
1188036157 X:25319263-25319285 TTGGGTAAACAATAAAATTAAGG - Intergenic
1188090728 X:25962027-25962049 TTGTTTAGACAACAAAATCAAGG - Intergenic
1188238924 X:27761452-27761474 CTGGGTACATAACAAAATGACGG + Intergenic
1188263675 X:28043930-28043952 TTGTATAAACAAGAAAAGCAGGG + Intergenic
1188291017 X:28389058-28389080 CTGGATACATAACGAAATGAAGG - Intergenic
1188420390 X:29984975-29984997 TTGGGTACATAACGAAATGAAGG - Intergenic
1188525139 X:31080558-31080580 CTGGGTACATAACAAAATGAAGG - Intergenic
1188697376 X:33211961-33211983 GTGGATACATAACAAATGCATGG - Intronic
1188871505 X:35378986-35379008 TTGGGTAAAGAACAAAATCAAGG - Intergenic
1188940557 X:36232855-36232877 CTGGATACATAACGAAATGAAGG - Intronic
1188958008 X:36457009-36457031 TTGGATAAACAACAACATGAAGG + Intergenic
1188969753 X:36599269-36599291 CTGGGTACACAACGAAATGAAGG + Intergenic
1189018325 X:37307918-37307940 CTGGGTACATAACAAAATGAAGG - Intergenic
1189049679 X:37631692-37631714 CTGGGTACATAACAAAATGAAGG - Intronic
1189199787 X:39183608-39183630 CTGGGTACATAACAAAATGAAGG - Intergenic
1189509651 X:41649495-41649517 CTGGGTACATAACAAAATGAAGG - Intronic
1189548068 X:42063803-42063825 TTGGGTAAACAATAAAATTAAGG - Intergenic
1189562464 X:42205400-42205422 CTGGGTACATAACAAAATGAAGG - Intergenic
1189583044 X:42428102-42428124 CTGGGTACATAACAAAATGAAGG - Intergenic
1189618810 X:42813914-42813936 CTGGATAAATAACAAAATGAAGG - Intergenic
1189696887 X:43673686-43673708 CTGGGTACATAACAAAATGAAGG - Intronic
1190590396 X:51994541-51994563 CTGGGTACATAACAAAATGAAGG - Intergenic
1190686483 X:52878542-52878564 CTGGGTACATAACAAAATGAAGG + Intergenic
1191038171 X:56050508-56050530 CTGGGTACATAACAAAATGAAGG - Intergenic
1191066682 X:56355859-56355881 TTGGGTACATAACAAAATGAAGG - Intergenic
1191078594 X:56484721-56484743 TTGGGTGAATAACAAAATCAAGG - Intergenic
1191087040 X:56579768-56579790 TTGGGTAAACAATAAAATCAAGG - Intergenic
1191145464 X:57161100-57161122 CTGGGTACATAACAAAATGAAGG - Intergenic
1191205274 X:57827187-57827209 CTGGGTACATAACGAAATCAAGG - Intergenic
1191579562 X:62745083-62745105 CTGGATACATAACGAAATGAAGG + Intergenic
1191635384 X:63370311-63370333 CTGGGTACACAACAAAATGAAGG + Intergenic
1191643088 X:63449600-63449622 CTGGGTACATAACAAAATGAAGG - Intergenic
1191647234 X:63494991-63495013 CTGGGTACATAACAAAATGATGG + Intergenic
1191704671 X:64082101-64082123 CTGGGTACATAACAAAATGATGG - Intergenic
1191746987 X:64500453-64500475 CTGGGTACACAACGAAATGAAGG - Intergenic
1191751413 X:64547060-64547082 CTGGGTACATAACAAAATGAAGG - Intergenic
1191755771 X:64590789-64590811 TTGGATACAGAAAAATATAAAGG - Intergenic
1191808474 X:65161001-65161023 CTGGGTACATAACAAAATGAAGG - Intergenic
1191828010 X:65386886-65386908 CTGGGTACATAACAAAATGAAGG - Intronic
1191933608 X:66402212-66402234 TTGGGTAAACAATAAAATTAAGG - Intergenic
1191938955 X:66456729-66456751 CTGGGTACATAACAAAATGAAGG + Intergenic
1192243464 X:69353644-69353666 CTGGGTACATAACAAAATGAAGG + Intergenic
1192280505 X:69680061-69680083 CTGGGTACACAACGAAATGAAGG - Intronic
1192352252 X:70366490-70366512 CTGGGTACATAACAAAATGAAGG - Intronic
1192598837 X:72440225-72440247 CTGGGTACATAACAAAATGAAGG + Intronic
1192695013 X:73404254-73404276 CTGGATAAATAACAAAATGAAGG + Intergenic
1192754882 X:74037183-74037205 CTGGGTACACAACAAAATGAAGG - Intergenic
1192767700 X:74159277-74159299 TAGGATAAATAACAAAATTAAGG + Intergenic
1192854732 X:74997272-74997294 CTGGGTACATAACAAAATGAAGG - Intergenic
1192887564 X:75351675-75351697 CTGGGTACATAACAAAATTAAGG - Intergenic
1192899470 X:75480585-75480607 AAGGATACACAACAAAGTCATGG - Intronic
1192900672 X:75492682-75492704 CTGGGTACATAACAAAATGAAGG + Intronic
1192906593 X:75558401-75558423 CTGGATACATAACGAAATGAAGG - Intergenic
1192910546 X:75599741-75599763 CTGGGTACATAACAAAATGAAGG - Intergenic
1192919661 X:75693399-75693421 CTGGGTACATAACAAAATGAAGG - Intergenic
1192956085 X:76071569-76071591 CTGGGTACATAACAAAATGAAGG + Intergenic
1192974662 X:76270171-76270193 CTGGATACATAACGAAATGAAGG + Intergenic
1192976417 X:76290758-76290780 CTGGATACATAACGAAATGATGG + Intergenic
1192980409 X:76333547-76333569 TTGAGTAAACAACAAAATTAAGG + Intergenic
1192983986 X:76376790-76376812 CTGGATACATAACGAAATGAAGG - Intergenic
1193002708 X:76581071-76581093 CTGGATACATAACGAAATGAAGG - Intergenic
1193036113 X:76953055-76953077 TTGGGTACATAACGAAATGAAGG + Intergenic
1193045491 X:77048990-77049012 CTGGGTACATAACAAAATGAAGG + Intergenic
1193123163 X:77844684-77844706 CTGGGTACATAACAAAATGAAGG - Intronic
1193182013 X:78469467-78469489 CTGGATACACAACAAAATGAAGG - Intergenic
1193184075 X:78491623-78491645 CTGGGTACATAACAAAATGAAGG - Intergenic
1193210915 X:78805834-78805856 CTGGGTACATAACAAAATGAAGG + Intergenic
1193244115 X:79208942-79208964 CTGGGTACATAACAAAATGAAGG - Intergenic
1193266725 X:79481160-79481182 TTGTGTAAACAACAAAATTAAGG - Intergenic
1193327992 X:80204954-80204976 TTGGGTAGACAACAAAATCAAGG - Intergenic
1193346294 X:80408002-80408024 CTGGATACATAACGAAATGAAGG + Intronic
1193367610 X:80653463-80653485 CTGGGTACATAACAAAATGAAGG + Intergenic
1193387707 X:80890859-80890881 CTGGGTACATAACAAAATGAAGG - Intergenic
1193440272 X:81532286-81532308 TTGGGTAAACAATAAAATTAAGG - Intergenic
1193489230 X:82127719-82127741 TTGAATAAATAAGAAAATCAAGG + Intergenic
1193495072 X:82201087-82201109 CTGGGTACACAATGAAATCAAGG - Intergenic
1193499466 X:82257200-82257222 TTGAATAAACAATAAAATTAAGG - Intergenic
1193542721 X:82791215-82791237 CTGGATAAATAACAAAATGAAGG + Intergenic
1193582569 X:83284150-83284172 CTGGGTACATAACAAAATGAAGG - Intergenic
1193591887 X:83398672-83398694 TTGAGTAAACAACAAAATTAAGG + Intergenic
1193613806 X:83664217-83664239 TTGGATAAATAATAAAATTAAGG - Intergenic
1193649511 X:84112573-84112595 TTGGGTGAACAACAAAATCAAGG + Intronic
1193725910 X:85039143-85039165 TTGGGTACACAATGAAATTAGGG - Intronic
1193735340 X:85149715-85149737 CTGGGTACACAACGAAATGAAGG + Intergenic
1193766247 X:85531967-85531989 CTGGGTACATAACAAAATGAAGG + Intergenic
1193773613 X:85617900-85617922 TTGGGTAAACAATAAAATTAAGG - Intergenic
1193785435 X:85754960-85754982 CTGGGTACATAACAAAATGAAGG - Intergenic
1193786845 X:85770129-85770151 CTGGGTACATAACAAAATGAAGG - Intergenic
1193806828 X:86005164-86005186 CTGGGTACATAACAAAATGAAGG + Intronic
1193835519 X:86338468-86338490 CTGGGTAAACAACAAAATTAAGG + Intronic
1193884898 X:86972390-86972412 CTGGATACATAACGAAATGAAGG + Intergenic
1193973562 X:88088693-88088715 TTGGGTAAACAATGAAATCAAGG - Intergenic
1194026714 X:88762097-88762119 TTGGGTAAACAACAAAATTAAGG - Intergenic
1194040540 X:88936935-88936957 TTGGATAAACAATGAAATTAAGG - Intergenic
1194075725 X:89390640-89390662 TTGGACTCAAAACAGAATCACGG + Intergenic
1194202853 X:90976367-90976389 CTGGGTACATAACAAAATTAAGG - Intergenic
1194217248 X:91146302-91146324 TTGGGTACACAATAAAATTAAGG - Intergenic
1194255603 X:91629991-91630013 CTGGGTACACAACGAAATGAAGG + Intergenic
1194271589 X:91822914-91822936 CTGGGTACATAACGAAATCAAGG - Intronic
1194315006 X:92366733-92366755 TTGGGTAAATAACAAAATTAAGG - Intronic
1194345229 X:92755459-92755481 TTGGGTGAACAACAAAATTAAGG + Intergenic
1194370315 X:93063068-93063090 CTGGGTACATAACAAAATGAAGG + Intergenic
1194402159 X:93451710-93451732 TAGAATAAACAACAAAATTAAGG - Intergenic
1194441819 X:93942636-93942658 CTGGGTACATAACAAAATGAAGG + Intergenic
1194516819 X:94865139-94865161 CTGGGTACATAACAAAATGAAGG + Intergenic
1194677567 X:96812761-96812783 CTGGGTACATAACAAAATGAAGG - Intronic
1194814666 X:98427570-98427592 CTGGATACATAACGAAATGAAGG - Intergenic
1194907603 X:99597229-99597251 CTGGATACATAAGAAAATGAAGG - Intergenic
1194963152 X:100258375-100258397 TTGGGTACATAACGAAATGAAGG + Intergenic
1194991620 X:100553028-100553050 CTGGATACATAACGAAATGAAGG + Intergenic
1195092414 X:101473709-101473731 CTGGATACATAACGAAATGAAGG + Intronic
1195103437 X:101579076-101579098 TTGGGTAAACAAGAAAATTAAGG - Intergenic
1195144848 X:102002979-102003001 TTGGGTAAACAATAAAATTAAGG + Intergenic
1195233434 X:102874420-102874442 TTGGGTACATAACAAAATGAAGG - Intergenic
1195340320 X:103900358-103900380 CTGGGTACATAACAAAATGAAGG - Intergenic
1195518076 X:105799673-105799695 CTGGGTACATAACAAAATGAAGG + Intergenic
1195531464 X:105962491-105962513 CTGGGTACATAACAAAATGAAGG + Intergenic
1195602890 X:106768956-106768978 ATGGGTACATAACAAAATGAAGG - Intronic
1195764332 X:108279894-108279916 CTGGGTACACAACGAAATGAAGG + Intronic
1195792758 X:108607064-108607086 TTGAATAGATAATAAAATCATGG + Intronic
1195817726 X:108906544-108906566 CTGGGTACATAACAAAATGAAGG + Intergenic
1195827036 X:109013268-109013290 CTGGGTACATAACAAAATGAAGG + Intergenic
1195904828 X:109833780-109833802 CTGGGTACATAACAAAATGAAGG + Intergenic
1195912041 X:109898712-109898734 CTGGGTACATAACAAAATGAAGG - Intergenic
1196171482 X:112593020-112593042 CTGGGTACATAACAAAATGAAGG + Intergenic
1196252845 X:113482157-113482179 CTGGCTACATAACAAAATGAAGG + Intergenic
1196359298 X:114833941-114833963 CTGGGTACATAACAAAATGAAGG - Intronic
1196472970 X:116050016-116050038 CTGGGTACATAACAAAATGAAGG - Intergenic
1196482162 X:116162092-116162114 CTGGGTACATAACAAAATGAAGG + Intergenic
1196490006 X:116254288-116254310 CTGGGTACATAACAAAATGAAGG + Intergenic
1196570762 X:117263560-117263582 CTGGGTACATAACAAAATGAAGG + Intergenic
1196597178 X:117558562-117558584 CTGGGTACATAACAAAATGAAGG + Intergenic
1196617179 X:117779698-117779720 CTGGATACATAACAAAAAGAAGG + Intergenic
1197239422 X:124107645-124107667 CTGGGTACATAACAAAATGAAGG - Intronic
1197369744 X:125612190-125612212 CTGGATACATAACGAAATGAAGG - Intergenic
1197410241 X:126107365-126107387 CTGGATACATAACGAAATGAAGG - Intergenic
1197565143 X:128074731-128074753 ATGGATAAACAACAAAATTAAGG + Intergenic
1197575120 X:128201824-128201846 CTGGATACATAACAAAATGAAGG + Intergenic
1197600875 X:128527865-128527887 TTGGATAGACAGCAACATTAAGG + Intergenic
1197676912 X:129339808-129339830 CTGGGTACATAACAAAATGAAGG + Intergenic
1197736866 X:129856886-129856908 CTGGGTACATAACAAAATGAAGG - Intergenic
1197888989 X:131248792-131248814 CTGGATACATAACGAAATGAAGG - Intergenic
1198165065 X:134047406-134047428 CTGGGTACATAACAAAATGAAGG - Intergenic
1198168987 X:134086288-134086310 TTGGGTACACAACAAAATTAAGG + Intergenic
1198298931 X:135315228-135315250 TTGGAAACAATACAAATTCATGG - Intronic
1198365841 X:135939001-135939023 CTGGGTACATAACAAAATGAAGG - Intergenic
1198484934 X:137077964-137077986 CTGGGTACATAACAAAATGAAGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198689267 X:139262421-139262443 CTGGATACAAAACAAAATGAAGG + Intergenic
1198976439 X:142340888-142340910 CTGGGTACATAACAAAATGAAGG + Intergenic
1199669684 X:150133260-150133282 CTGGATACATAACGAAATGAAGG + Intergenic
1199786325 X:151109189-151109211 TTGAATAAATAACAAAATTAAGG - Intergenic
1199884862 X:152009651-152009673 CTGGGTACATAACAAAATGAAGG + Intergenic
1199916716 X:152350207-152350229 CTGGGTACATAACAAAATGAAGG + Intronic
1200343553 X:155424867-155424889 CTGGGTACATAACAAAATGAAGG + Intergenic
1200548690 Y:4551813-4551835 CTGGGTACATAACAAAATTAAGG - Intergenic
1200553762 Y:4610094-4610116 TTGGGTACACAATAAAATTAAGG - Intergenic
1200574339 Y:4869252-4869274 CTGGGTACACAACAAAATGAAGG + Intergenic
1200623056 Y:5478259-5478281 TTGGGTAAATAACAAAATTAAGG - Intronic
1200653572 Y:5872110-5872132 TTGGGTGAACAACAAAATTAAGG + Intergenic
1200693488 Y:6332877-6332899 CTGGATACATAACGAAATGAAGG + Intergenic
1200731326 Y:6744795-6744817 TTGGACTCAAAACAGAATCACGG + Intergenic
1200731751 Y:6750180-6750202 CTGGGTAAACAACAAAATTAAGG - Intergenic
1200784969 Y:7252790-7252812 CTGGATACATAACGAAATGAAGG - Intergenic
1200864674 Y:8030506-8030528 CTGGGTACATAACAAAATGAAGG + Intergenic
1201041787 Y:9841848-9841870 CTGGATACATAACGAAATGAAGG - Intergenic
1201263551 Y:12183727-12183749 CTGGGTACATAACAAAATGAAGG + Intergenic
1201350548 Y:13035959-13035981 CTGGGTACATAACAAAATGAAGG + Intergenic
1201422016 Y:13809956-13809978 CTGGGTACATAACAAAATGAAGG - Intergenic
1201453801 Y:14146023-14146045 TTACAGACACAACAAAATCTGGG + Intergenic
1201466332 Y:14285046-14285068 CTGGGTACATAACAAAATGAAGG + Intergenic
1201595676 Y:15665997-15666019 CTGGATAAATAACAAAATTAAGG - Intergenic
1201732130 Y:17215635-17215657 CTGGGTACATAACAAAATGAAGG + Intergenic
1201783579 Y:17748657-17748679 CTGGATAAATAACGAAATCAAGG + Intergenic
1201817974 Y:18157330-18157352 CTGGATAAATAACGAAATCAAGG - Intergenic
1201908789 Y:19112158-19112180 CTGGGTACATAACAAAATGAAGG - Intergenic
1201970207 Y:19784353-19784375 TTGAATACACAACAAAATTAAGG + Intergenic
1202014250 Y:20383802-20383824 CTGGATACATAACGAAATGAAGG - Intergenic
1202057910 Y:20854988-20855010 CTGGGTACATAACAAAATGAAGG - Intergenic
1202064404 Y:20923090-20923112 CTGGGTACATAACAAAATGAAGG - Intergenic
1202084944 Y:21126762-21126784 CTGGGTACATAACAAAATGAAGG - Intergenic
1202171033 Y:22043812-22043834 TTGGGTACATAACAAAATGAAGG + Intergenic
1202189809 Y:22230178-22230200 CTGGGTACATAACAAAATGAAGG - Intergenic
1202220329 Y:22542561-22542583 TTGGGTACATAACAAAATGAAGG - Intergenic
1202241608 Y:22776527-22776549 CTGGGTACATAACAAAATGAAGG - Intergenic
1202278218 Y:23147439-23147461 CTGGGTACATAACAAAATGAAGG + Intronic
1202286985 Y:23261328-23261350 CTGGGTACATAACAAAATGAAGG - Intronic
1202322784 Y:23653102-23653124 TTGGGTACATAACAAAATGAAGG + Intergenic
1202327555 Y:23707366-23707388 CTGGGTACATAACAAAATGAAGG + Intergenic
1202331614 Y:23759159-23759181 CTGGGTACATAACAAAATGAAGG + Intergenic
1202333153 Y:23776240-23776262 TTGGGTACATAACGAAATGAAGG - Intergenic
1202394591 Y:24410271-24410293 CTGGGTACATAACAAAATGAAGG - Intergenic
1202431042 Y:24778777-24778799 CTGGGTACATAACAAAATGAAGG + Intronic
1202438926 Y:24879385-24879407 CTGGGTACATAACAAAATGAAGG - Intronic
1202476193 Y:25259821-25259843 CTGGGTACATAACAAAATGAAGG + Intergenic
1202537616 Y:25893823-25893845 TTGGGTACATAACGAAATGAAGG + Intergenic
1202539156 Y:25910901-25910923 CTGGGTACATAACAAAATGAAGG - Intergenic
1202543215 Y:25962686-25962708 CTGGGTACATAACAAAATGAAGG - Intergenic
1202547989 Y:26016954-26016976 TTGGGTACATAACAAAATGAAGG - Intergenic