ID: 1077822687

View in Genome Browser
Species Human (GRCh38)
Location 11:5765254-5765276
Sequence CCTCTTTGTTGATGATGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077822687_1077822691 11 Left 1077822687 11:5765254-5765276 CCTGATCATCATCAACAAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 123
Right 1077822691 11:5765288-5765310 CAGCCTATGTACTATTTCCTGGG 0: 1
1: 1
2: 0
3: 7
4: 119
1077822687_1077822690 10 Left 1077822687 11:5765254-5765276 CCTGATCATCATCAACAAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 123
Right 1077822690 11:5765287-5765309 CCAGCCTATGTACTATTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 101
1077822687_1077822694 25 Left 1077822687 11:5765254-5765276 CCTGATCATCATCAACAAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 123
Right 1077822694 11:5765302-5765324 TTTCCTGGGCATCTTGGCTATGG 0: 1
1: 0
2: 0
3: 15
4: 242
1077822687_1077822693 19 Left 1077822687 11:5765254-5765276 CCTGATCATCATCAACAAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 123
Right 1077822693 11:5765296-5765318 GTACTATTTCCTGGGCATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077822687 Original CRISPR CCTCTTTGTTGATGATGATC AGG (reversed) Intronic
905561468 1:38930567-38930589 CATCTTTGTTGATGGTGATTGGG + Intronic
907735069 1:57104319-57104341 CGTCTTGGTTGATGATGAATTGG + Intronic
910335097 1:86119338-86119360 CCACTTTTTTGATTATGATAAGG + Intronic
911227953 1:95327955-95327977 ATTCCTTGTTGATGATGATCTGG - Intergenic
918156894 1:181856427-181856449 CCTCTCTGATGATTATGATGAGG + Intergenic
918650464 1:186956307-186956329 CTCCTTTGATGATGATGAACTGG + Exonic
919895970 1:202010144-202010166 CCTCTTTGTTGCTGAATCTCTGG + Exonic
920472702 1:206245510-206245532 CCAGTTTGTTGAAGATGATAAGG + Intronic
921078813 1:211722412-211722434 CATATTTGTTCATGATGATTTGG - Intergenic
921916371 1:220615359-220615381 CCTCTTTTCTGTTGCTGATCAGG + Intronic
922561269 1:226571438-226571460 CCTATTTGGTGATGAAGACCAGG + Intronic
923281989 1:232452294-232452316 CCTCTTTGCTGATCATGTTCAGG - Intronic
1063790066 10:9434526-9434548 CCTCTGTGAAGATGATGATATGG + Intergenic
1064362485 10:14678521-14678543 CCTCTTTGTTGATGAGTTTCTGG - Intronic
1066037751 10:31510179-31510201 ACTCTTTGATGATGATGACTTGG + Intronic
1067098754 10:43319604-43319626 TCTCCTTGGCGATGATGATCAGG - Intergenic
1067882815 10:50061480-50061502 GCTCTTTGATGATGAGGATGAGG - Intergenic
1067930400 10:50555114-50555136 CCTCTTTCTTGCTGAGGCTCAGG - Intronic
1070911486 10:80122641-80122663 CATCTTTGTTGATGAGGCTCAGG + Intergenic
1073441270 10:103554114-103554136 CTGCTCTCTTGATGATGATCTGG + Intronic
1073603914 10:104874168-104874190 CCTCTTTGTTTAAGAGGATTTGG + Intronic
1073936760 10:108641590-108641612 CCTCTTAGTTGATGATGTTTTGG - Intergenic
1073959884 10:108913286-108913308 CCTTTTTGTTGTTGTTGTTCTGG + Intergenic
1076656568 10:132027863-132027885 TGTCTTTGGTGATGATGATATGG + Intergenic
1077176725 11:1194483-1194505 CCTTGTTGTTGAAGATGATCTGG - Intronic
1077822687 11:5765254-5765276 CCTCTTTGTTGATGATGATCAGG - Intronic
1080804401 11:35639210-35639232 CTTCTTTATTGATGTTGATGGGG + Intergenic
1083976442 11:66125501-66125523 CCTCTATTTTGAAGATGTTCTGG + Intronic
1085790399 11:79492843-79492865 CCTCTCTGTTGACGGAGATCTGG - Intergenic
1086407724 11:86513157-86513179 CCTCTTTGTTGAAGATAAGAAGG + Intronic
1091346133 11:134855411-134855433 CATGTTTGTTAATGATGATGGGG + Intergenic
1094723834 12:33092190-33092212 CCTCTTTATAGATGATGAAATGG + Intergenic
1094727141 12:33131993-33132015 CCTGTTTGTTGATGGTCCTCTGG + Intergenic
1098140214 12:67443342-67443364 CCTCTGTGTTGATGCTGATGTGG + Intergenic
1100245600 12:92753654-92753676 CCTCTTAGTTGGGGAGGATCAGG - Intronic
1103267838 12:119645959-119645981 CCTCTTTCTTGGGGGTGATCAGG - Intergenic
1104410130 12:128550887-128550909 CCTCTTTGCTGATGATGGACAGG + Intronic
1105483959 13:20807608-20807630 CCTCTTAGCTGATGATACTCAGG - Exonic
1106899104 13:34336105-34336127 CTTGTTTGTTGCTGATGGTCTGG - Intergenic
1107292004 13:38865285-38865307 CAACTTTGTTGCTGATGATGGGG - Intronic
1109363861 13:61330248-61330270 CTCCTTTCTTGATGATAATCAGG - Intergenic
1109665209 13:65525794-65525816 CCTGTTAGTTGCTGATGATGTGG + Intergenic
1109771330 13:66977456-66977478 CCTTTTTGTTGTTGATGAGAAGG - Intronic
1111059834 13:83001941-83001963 CTTATTTGTTTATGATAATCAGG - Intergenic
1112071503 13:95856157-95856179 CATTTTTGTTGATGCTGACCAGG - Exonic
1112646800 13:101342386-101342408 CTGCTTTGTTGCTGCTGATCTGG - Intronic
1114042121 14:18688629-18688651 CCTCTTTGTTGGTGAGACTCAGG + Intergenic
1114055082 14:18961076-18961098 CCTCTTTGTTGTTGTTGTTGAGG + Intergenic
1114107459 14:19440702-19440724 CCTCTTTGTTGTTGTTGTTGAGG - Intergenic
1117803806 14:59469646-59469668 CCTCTTTGTTGATGCTCCTGAGG - Intronic
1117816544 14:59604862-59604884 CCTCTCACTTGATGAGGATCAGG - Intronic
1119358021 14:74023182-74023204 CCTCTATGGTGATGCTGATGTGG + Intronic
1120658045 14:87219156-87219178 CCTCTTTCTTAATGATGGACAGG - Intergenic
1121849881 14:97211890-97211912 GCTCTCTGTTGATGTTGGTCAGG - Intergenic
1123873798 15:24603136-24603158 CAACTTTGTTGAAGATCATCTGG + Intergenic
1124682250 15:31743078-31743100 TATATTTGTTGATGATGTTCTGG - Intronic
1128378356 15:67093250-67093272 CCTCTATGTTGATGCAAATCAGG + Intronic
1136582603 16:31162444-31162466 TCTCTTTGTCAATGATGACCAGG - Intergenic
1139538986 16:67599610-67599632 CTTCTGTGTAGATGATGAACAGG - Intronic
1146534715 17:33640076-33640098 CCTCTTTCTTGAGGATAATTCGG + Intronic
1147768426 17:42851883-42851905 GCTCTCTGTTGAAGATCATCTGG - Exonic
1149920408 17:60653318-60653340 CACCTTTGTTGAAGATGAGCTGG + Intronic
1151749463 17:76028384-76028406 CCTCTTTCTTGAAGACGCTCAGG - Intergenic
1153469248 18:5425267-5425289 CTTGTTTGTTGAGGATGATTAGG + Intronic
1155613514 18:27695576-27695598 CCTGTTTGCTGATGATGATACGG - Intergenic
1158736781 18:60091365-60091387 CCCTTTTGTAGATCATGATCTGG - Intergenic
1160083717 18:75754427-75754449 GCTCTTTGTTGATCATGCTAGGG - Intergenic
926926220 2:17990333-17990355 CCTCTTTGTTGGAGATGATTTGG - Intronic
928270432 2:29850343-29850365 CCTGTTTCTTGATCATGATGTGG + Intronic
932563874 2:72893714-72893736 GCTCCTTGTGGATGATCATCGGG + Intergenic
932697198 2:73966886-73966908 CCTCTTAGAAGATGATGACCAGG + Intergenic
935557213 2:104522905-104522927 TCTCTTTGTTGATAATTTTCAGG + Intergenic
935763781 2:106344619-106344641 CGTCTTTGTTGGTGGTGCTCAGG - Intergenic
938051885 2:128181051-128181073 CCTGTTTGTGGATGCTGATCAGG + Exonic
938536822 2:132254597-132254619 CCTCATTGGCGATGGTGATCAGG - Intronic
939755082 2:146100317-146100339 CCCCTTTGTTCATGAGGTTCTGG - Intergenic
946508198 2:220324352-220324374 CCTGTTCGTTGATGATAATATGG + Intergenic
946634368 2:221707950-221707972 CCACTTTTTTGATGATGTTGGGG + Intergenic
1169515300 20:6310460-6310482 CCACTTTGTTCATGCTGCTCTGG - Intergenic
1169523267 20:6395760-6395782 CCACTTTGCTTATGATTATCTGG + Intergenic
1169969201 20:11250421-11250443 TCTCTTTTTTGATGATGCTGTGG + Intergenic
1170803311 20:19608262-19608284 TTTCTTTGGTGATGATGATATGG + Intronic
1170967016 20:21082725-21082747 CCTGTCTGTTCATGATGATCAGG - Intergenic
1171865721 20:30486374-30486396 CCTCATTGGCGATGGTGATCGGG - Intergenic
949133698 3:536431-536453 CCTCTTTCTTGAGGATGAGAAGG - Intergenic
949306342 3:2645740-2645762 ACTCTTTGTTCATGATGAAGAGG + Intronic
949797914 3:7870935-7870957 TCTCTTTGTTGATGTTGAACTGG - Intergenic
953549385 3:43889643-43889665 GGTCTTTGCTGAGGATGATCAGG + Intergenic
959693287 3:109222424-109222446 CAACTTTGTTGAAGATGAGCTGG - Intergenic
962653998 3:137524082-137524104 CCTATTTGATGATAAAGATCTGG + Intergenic
963629544 3:147715803-147715825 CCTATTTGTTGATCTTGATGAGG + Intergenic
963998458 3:151739189-151739211 CCTTTTTGTTGATGTTGATGTGG + Intronic
965421848 3:168469929-168469951 CCTCTTACTTGATAATTATCAGG + Intergenic
966332155 3:178826281-178826303 CTTCTGGGTTGATGATGATGGGG - Intronic
968254256 3:197251494-197251516 CATCTTTGTTGAAGATGAGTTGG - Intronic
970492798 4:16592093-16592115 CCTCTTTCTTGTTGATCCTCCGG - Intronic
972479189 4:39481589-39481611 CCTCCTTTTTGAAGATGATTTGG + Intergenic
973612362 4:52648202-52648224 CTACTTTGTAGATGATGGTCTGG - Intronic
973852600 4:54976218-54976240 TCTCTTTGTCAGTGATGATCAGG + Intergenic
979741781 4:124159882-124159904 CTTGTTTGTTGCTGATTATCAGG + Intergenic
982336744 4:154248016-154248038 CCTCTTTTTTCATGAAGACCTGG - Intronic
982725489 4:158902182-158902204 CCTTTTTGTTGATGTTGATGTGG + Intronic
992086160 5:73280322-73280344 CCTCTGTCTTGATGCTGACCTGG - Intergenic
995002678 5:107153778-107153800 CTTCTTTGTTTTTAATGATCAGG + Intergenic
995678301 5:114688243-114688265 CTTCTGTGATGATGATGATGGGG - Intergenic
1000128255 5:158268661-158268683 TCTCTGTGTTGTTGATGGTCAGG + Intergenic
1003695787 6:8405349-8405371 CCACTTTGTTCATGATGACAGGG + Intergenic
1005521473 6:26604588-26604610 CCTCTTTGTTTATGATATTTTGG + Intergenic
1011919961 6:92561471-92561493 CATCTTTGTTGAAGATGAGATGG + Intergenic
1014168833 6:118255420-118255442 CCTCCTTGTTGAGGATCATCGGG - Intronic
1018663694 6:166113868-166113890 ACTCTTTGTTCAGGATGCTCAGG - Intergenic
1022376360 7:29815327-29815349 ACTCTTTGTTGCTGTTGTTCTGG + Intronic
1031074551 7:117200026-117200048 CCTCCTTGGTGATAATGACCAGG - Intronic
1031222949 7:118995499-118995521 CCTGTTTGTTGATGCTGCTGAGG - Intergenic
1031815693 7:126432266-126432288 CCTATTTGTAGATGATGAACTGG - Intergenic
1032682652 7:134201467-134201489 TCTCTTTGCTGCAGATGATCTGG + Exonic
1035142585 7:156777544-156777566 CCACTTTGTGGTTGATGCTCAGG - Intronic
1037628109 8:20626166-20626188 CCACCTTGTTAATGATGATTGGG + Intergenic
1038617525 8:29108852-29108874 CCTCATTTTTGATGAAGATGTGG - Intronic
1041591561 8:59591579-59591601 CCTTTATGATGATGATGATGTGG - Intergenic
1047922974 8:129654208-129654230 ACTCTTTGTTGTAGATGATTAGG - Intergenic
1051054866 9:12973034-12973056 CCTCTTTATCGTTGATGATATGG - Intergenic
1052203756 9:25813271-25813293 TCTCTTAATTGCTGATGATCTGG - Intergenic
1056293545 9:85168739-85168761 CTTCTTTGTTGCTTATGAACAGG - Intergenic
1057364013 9:94401550-94401572 CCTTTTTCTTGTTGACGATCGGG + Intronic
1057659325 9:96986511-96986533 CCTTTTTCTTGTTGACGATCGGG - Intronic
1058393859 9:104526792-104526814 CCACCTTGTTCATGATGATGGGG + Exonic
1058459740 9:105171985-105172007 CCTCTTTGTCGATCAAGCTCTGG + Intergenic
1059613295 9:115922242-115922264 CCTGTGTGTTTATGAAGATCAGG + Intergenic
1061131388 9:128710281-128710303 ATTATTTGTTGATGATGATTTGG - Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1187239992 X:17503627-17503649 TCTCTCTGTTGAGGATTATCTGG + Intronic
1188349460 X:29110112-29110134 CCTTTTTGTTGTTGTTGTTCAGG - Intronic
1190597123 X:52061436-52061458 CCTCCTTGGAGATGATGTTCCGG - Intergenic
1190611701 X:52192637-52192659 CCTCCTTGGAGATGATGTTCCGG + Intergenic
1194093057 X:89601833-89601855 CCTCTTTATTCATGATGACTTGG + Intergenic
1195166452 X:102225147-102225169 TCTCTTTCTTGGTGATGTTCTGG - Exonic
1195192408 X:102461941-102461963 TCTCTTTCTTGGTGATGTTCTGG + Exonic
1195295416 X:103471869-103471891 CCCCTTTGGTGATGATGATGAGG - Intergenic
1196993176 X:121350215-121350237 TCTCTTTGGTGATGCTTATCAGG + Intergenic
1199195030 X:145018315-145018337 CATCTTTGTTGAAGATGAGTTGG - Intergenic
1199256268 X:145721803-145721825 CATCTCTCTTGATGATGAACTGG - Intergenic
1200445691 Y:3257936-3257958 CCTCTTTATTCATGATGACTTGG + Intergenic