ID: 1077822958

View in Genome Browser
Species Human (GRCh38)
Location 11:5768501-5768523
Sequence GGCACTAGTATGTTTATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077822958_1077822961 24 Left 1077822958 11:5768501-5768523 CCTGTGATAAACATACTAGTGCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 1077822961 11:5768548-5768570 AAATGCAATTATCTTCTTTTGGG 0: 1
1: 1
2: 3
3: 58
4: 591
1077822958_1077822960 23 Left 1077822958 11:5768501-5768523 CCTGTGATAAACATACTAGTGCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 1077822960 11:5768547-5768569 TAAATGCAATTATCTTCTTTTGG 0: 1
1: 0
2: 4
3: 49
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077822958 Original CRISPR GGCACTAGTATGTTTATCAC AGG (reversed) Intronic
904459473 1:30667565-30667587 GGCATAAATATGTTTACCACAGG - Intergenic
904791518 1:33025743-33025765 GGTAATAGTATCTGTATCACTGG + Intronic
908274579 1:62456865-62456887 GGGACTAGTATGTTTCCCATTGG + Intronic
910566601 1:88650757-88650779 CTCCCTAATATGTTTATCACAGG - Intergenic
911227553 1:95323617-95323639 GGCAATATTATGTTTAACACTGG + Intergenic
917272558 1:173294147-173294169 TGCACTCGTATGTTCATCATGGG + Intergenic
917815985 1:178710889-178710911 GGCACCAGTATGATTTTCTCAGG - Intergenic
919020902 1:192104398-192104420 GCAACTAATATGCTTATCACAGG + Intergenic
920905283 1:210158305-210158327 TGCACTCTTATGTTTGTCACAGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1068381354 10:56257367-56257389 TGCACTGGTATGTTCATCACAGG - Intergenic
1070611166 10:77933755-77933777 GGAGCTATTCTGTTTATCACAGG - Intergenic
1073890824 10:108098504-108098526 TGTACTACCATGTTTATCACAGG + Intergenic
1077822958 11:5768501-5768523 GGCACTAGTATGTTTATCACAGG - Intronic
1085894647 11:80624035-80624057 GGAAGTAGTATGTTTCCCACTGG + Intergenic
1087580418 11:100044276-100044298 TGCACTCATATGTTTATCACGGG - Intronic
1087988347 11:104713473-104713495 TGCATTTGTATGTTTATCATAGG - Intergenic
1089133905 11:116234255-116234277 GGTACTATTTTGTTCATCACCGG - Intergenic
1089219360 11:116858101-116858123 GGCACAAGAATGTGTCTCACAGG - Exonic
1093449720 12:19301402-19301424 GCTACTACTATGTTTATCCCTGG - Intronic
1095786633 12:46116778-46116800 TGCACACATATGTTTATCACAGG + Intergenic
1096378688 12:51136531-51136553 GGGCCTAGTATGTTTATAGCAGG + Intronic
1100573470 12:95865441-95865463 GGCACTAATATATTTAGAACAGG - Intronic
1100796857 12:98191486-98191508 TGGACAAGTATGTCTATCACAGG + Intergenic
1104737754 12:131148656-131148678 TGCACATGTATGTTGATCACAGG - Intergenic
1108709179 13:53016283-53016305 GGCACTATTCTGTCTACCACAGG - Intergenic
1110157457 13:72335104-72335126 GGCACTAACAGGTTTATCTCTGG - Intergenic
1114132036 14:19802314-19802336 TGCACAAGTATGTTCATCACAGG - Intronic
1114594906 14:23903366-23903388 TGCACACGTATGTTTATCACAGG - Intergenic
1115473454 14:33791877-33791899 GGTTCTAGTATGTTTAACAAAGG - Intronic
1117826485 14:59709823-59709845 GGCAATTCCATGTTTATCACGGG + Intronic
1124338298 15:28873563-28873585 TGCACTGGGATGTTTATCTCTGG - Intergenic
1131044675 15:89304649-89304671 GGCTGTAGTATGTGTAACACTGG + Intronic
1135620514 16:23951369-23951391 GGCACTTGTATTTTTTTCTCTGG + Intronic
1158842192 18:61399555-61399577 GGCAGTAGTATGTTTTCCAGTGG - Intronic
1159148243 18:64482760-64482782 TGCACCCATATGTTTATCACAGG - Intergenic
1159633257 18:70774270-70774292 AGCACGAATGTGTTTATCACTGG + Intergenic
1164349664 19:27320489-27320511 TGCACAAGTATGTTTATTGCAGG + Intergenic
925485157 2:4320384-4320406 TGCACTCATATGTTTATCACAGG - Intergenic
931334476 2:61325228-61325250 GGCACATGTATGTTTGTTACAGG - Intronic
933304664 2:80582231-80582253 GGCACTACTTTGTTTATAGCTGG + Intronic
940418720 2:153453810-153453832 TGCACTCATATGTTCATCACAGG + Intergenic
941489464 2:166125610-166125632 GGAACTAGAATGTTTCTTACTGG + Intronic
941617842 2:167741599-167741621 GGGAGGAGTATTTTTATCACTGG - Intergenic
942546714 2:177072795-177072817 GGCCATAGTTTGTTGATCACTGG - Intergenic
943901665 2:193446505-193446527 TGCAATTGTATGTTTATCATAGG - Intergenic
1170178409 20:13499008-13499030 TGCACTCATATGTTCATCACAGG + Intronic
1178026374 21:28472953-28472975 TGCACTTGTATGTTTATTGCAGG + Intergenic
1178194252 21:30324943-30324965 GACAGTAGTATGATAATCACAGG - Intergenic
1179021260 21:37643152-37643174 AGTCCTAGTATGTTTACCACTGG + Intronic
1179327337 21:40360761-40360783 TGCACTTGTATGTTCATCGCTGG - Intronic
1182798243 22:33007049-33007071 TGCACAAATATGTTAATCACAGG + Intronic
949735222 3:7163999-7164021 GTCCCTTGCATGTTTATCACAGG - Intronic
949919813 3:8991787-8991809 GGCACTAGGATCTGAATCACTGG - Intronic
958941867 3:100325739-100325761 GTCACTGGTATGTTTCACACAGG + Intergenic
960542217 3:118873721-118873743 GGCACTAATCTGTTTATGAGAGG - Intergenic
965300096 3:166997844-166997866 GGCACTGGGATTTTTAACACAGG - Intergenic
966061071 3:175756367-175756389 TGCATTCATATGTTTATCACAGG + Intronic
966645337 3:182240057-182240079 GGTATTAGTATGGTTATTACTGG + Intergenic
967762887 3:193244796-193244818 GGAACTAGTGGCTTTATCACAGG - Intronic
970310196 4:14774754-14774776 TGCACCTGTATGTTTATCACAGG + Intergenic
970387337 4:15568862-15568884 GCCAGTAGGAGGTTTATCACTGG + Intronic
977866674 4:102036528-102036550 GGACATAGTATGTATATCACAGG + Intronic
978761279 4:112358031-112358053 GGCAGTAGTGTGATCATCACGGG + Intronic
981918487 4:150060788-150060810 GGTACTTATGTGTTTATCACTGG + Intergenic
985294327 4:188418815-188418837 GCCAATAGTCTGTTCATCACAGG + Intergenic
987627214 5:20418035-20418057 GGCACTAGTCTCTTTATCTGTGG - Intronic
1012794360 6:103740743-103740765 GGAACAAGTAGGTTTAGCACTGG - Intergenic
1013881316 6:114904624-114904646 TGCACTCATATGTTTATCACAGG + Intergenic
1015042171 6:128734635-128734657 GGAACTAGTATAGTTATCTCTGG + Intergenic
1022235935 7:28460363-28460385 AGCACTAGCATGTATATCATTGG - Intronic
1026057791 7:66999855-66999877 GGTAATAGTATGGTTATCTCAGG + Intronic
1028330979 7:89591627-89591649 AGCACATGTATTTTTATCACTGG - Intergenic
1028699958 7:93765965-93765987 TGCACTCATATGTTTATCTCAGG + Intronic
1031819575 7:126483367-126483389 GTCACTACAATGTTTATCACAGG + Intronic
1031819602 7:126483669-126483691 GTCACTACAATGTTTATCACAGG + Intronic
1031819642 7:126483981-126484003 GTCACTACAATGTTTATCACAGG + Intronic
1034848039 7:154465901-154465923 TGCACTTGTATGTTTATTGCAGG + Intronic
1037499675 8:19473424-19473446 GTCACTAACATGATTATCACAGG + Intronic
1043845944 8:85164257-85164279 GGCACTAGTTAGATTCTCACAGG + Intergenic
1044056513 8:87577303-87577325 GGCAGTGTTATGTTTGTCACAGG - Intronic
1045817220 8:106290987-106291009 TGCACTAGTATGTTCATTGCTGG + Intronic
1046419894 8:113966799-113966821 GGAACTAATATCATTATCACTGG + Intergenic
1047139993 8:122127462-122127484 GGCAGTAGAATGTTGAGCACTGG - Intergenic
1051870779 9:21735382-21735404 GGCACTAGTCTGGGTAGCACTGG - Intergenic
1055747945 9:79471343-79471365 GGCACTTCTGAGTTTATCACAGG + Intergenic
1057970083 9:99546522-99546544 GGCACTACTATGTTTATTGCAGG - Intergenic
1061195260 9:129103745-129103767 GTCACTGGTATTTTTATCTCTGG + Intronic
1186926838 X:14342978-14343000 GGAACTAGTACCATTATCACAGG - Intergenic
1188406262 X:29814038-29814060 TGCACTTGTATGTTCATCACAGG - Intronic
1195663711 X:107408555-107408577 TGCACTCATATGTTTATCACAGG - Intergenic
1199136434 X:144259011-144259033 CACACTTGTATGTTCATCACTGG - Intergenic