ID: 1077827804

View in Genome Browser
Species Human (GRCh38)
Location 11:5830002-5830024
Sequence CACCGTATGCTCTCACTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25749
Summary {0: 3, 1: 158, 2: 5601, 3: 13584, 4: 6403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077827801_1077827804 18 Left 1077827801 11:5829961-5829983 CCATCATTCTCAGCAAACTATCG 0: 3934
1: 8775
2: 8908
3: 5852
4: 4489
Right 1077827804 11:5830002-5830024 CACCGTATGCTCTCACTCATAGG 0: 3
1: 158
2: 5601
3: 13584
4: 6403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077827804 Original CRISPR CACCGTATGCTCTCACTCAT AGG Intronic