ID: 1077828325

View in Genome Browser
Species Human (GRCh38)
Location 11:5835063-5835085
Sequence CAGTGGGGCTGGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 1, 2: 8, 3: 103, 4: 789}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077828325_1077828333 -5 Left 1077828325 11:5835063-5835085 CCCTCTTTCCTCCAGCCCCACTG 0: 1
1: 1
2: 8
3: 103
4: 789
Right 1077828333 11:5835081-5835103 CACTGTGGTTCACTCACTTTTGG 0: 1
1: 0
2: 2
3: 27
4: 215
1077828325_1077828334 28 Left 1077828325 11:5835063-5835085 CCCTCTTTCCTCCAGCCCCACTG 0: 1
1: 1
2: 8
3: 103
4: 789
Right 1077828334 11:5835114-5835136 TTATGTCCAGATCTAATGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077828325 Original CRISPR CAGTGGGGCTGGAGGAAAGA GGG (reversed) Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901852630 1:12025681-12025703 CCGCGAGGCTGGAAGAAAGACGG - Intronic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903178626 1:21594663-21594685 AGGTGGGGCAGGAGGAGAGAGGG + Intergenic
903477430 1:23629171-23629193 CAGTGGGGCTGGGGCAAGGGAGG - Intronic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903549813 1:24150091-24150113 AAGTGGGGCTGAAGTAATGAGGG - Intergenic
904292593 1:29497593-29497615 GATTGGGGCTGGCGGGAAGATGG - Intergenic
904698953 1:32346915-32346937 GAGAGGGGCTGGAGGAGGGAGGG + Intergenic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
906009338 1:42509167-42509189 CTTTGGGGCTGGAAGCAAGATGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907338919 1:53719636-53719658 AACTGGGGCAGGAGGAAGGAGGG + Intronic
907684124 1:56593325-56593347 TAGAGGGGTTGGAGGAAACAGGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
909465509 1:75969581-75969603 CAGTGGGGCAGAGGGAATGATGG + Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
911667596 1:100571665-100571687 CAGGGGGGATGATGGAAAGAGGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913089594 1:115467568-115467590 CATTAAGGCTGGAGGAAGGAAGG + Intergenic
913439614 1:118883992-118884014 CAGTGGTGCCCGTGGAAAGAGGG - Exonic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
914931855 1:151942056-151942078 CATTAGGGCTGGAGGAAATAGGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915515367 1:156409562-156409584 GAATGGGGCTGGAGGAAGGGAGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916687725 1:167162306-167162328 GAGTGGGGCCTGAGGCAAGAGGG - Intergenic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919500374 1:198330705-198330727 CAGGGATGCTGGAGGAAAGGTGG - Intergenic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
919885163 1:201928361-201928383 TAGTGAGGCTGGAGCAAAGGAGG - Intronic
919921658 1:202169766-202169788 CACAGGGGCTGGAGGAAGGATGG - Intergenic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920188321 1:204176300-204176322 CACTGCAGCAGGAGGAAAGAAGG + Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921614536 1:217250926-217250948 AGGTTGGGCTGGAGTAAAGATGG - Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
1062819231 10:521869-521891 CGGTGGGGGTGGGGGAATGATGG - Intronic
1063294443 10:4790255-4790277 GAGTGGGGTTGGAGGAAACCTGG + Intronic
1063523503 10:6761801-6761823 CATTTGGGCTAGAGGAGAGAAGG - Intergenic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064667022 10:17664422-17664444 AAGAGGAGCTGGAGGAAAGGGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065874528 10:29985450-29985472 GGTTGGAGCTGGAGGAAAGATGG - Intergenic
1065998724 10:31084194-31084216 CCCTGGGGCTGGAGGAAGAAAGG - Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069986309 10:72286561-72286583 AAGTGGGGCTGGAGGCAGGGTGG + Intergenic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1070729229 10:78813845-78813867 GAATGGGGCAGGAGGAAGGAGGG - Intergenic
1070782360 10:79145096-79145118 CAGAGGGGGAGGGGGAAAGAGGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071292878 10:84200418-84200440 CAGAGAGGGTGCAGGAAAGAGGG - Intronic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073957442 10:108889661-108889683 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075407786 10:122206083-122206105 CTGGGGGGCGGGGGGAAAGAGGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076995289 11:294695-294717 CGGTGGGGCTGGAGGAACCCAGG - Exonic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1078597294 11:12698346-12698368 AAGTGGGGGTGGAGGATGGAGGG + Intronic
1078634091 11:13032862-13032884 CCAGGGAGCTGGAGGAAAGAGGG + Intergenic
1079024992 11:16940032-16940054 CACTGGTGCTGGGGGCAAGAAGG + Intronic
1079029566 11:16976397-16976419 GAGGGGTGCTGGAGGAAACAAGG - Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079990184 11:27238227-27238249 CAGTGGGGCTGAGAGAATGAGGG - Intergenic
1080209846 11:29772926-29772948 CAATGGAGCAGGAGGATAGAAGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1081225700 11:40519445-40519467 TAGTAAGGCTGAAGGAAAGAAGG - Intronic
1081321576 11:41698087-41698109 CAGAGCTGCTGGAAGAAAGATGG + Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082001511 11:47395735-47395757 CAGGGAGGCAGGAGGAAGGAGGG - Intergenic
1082262004 11:50083592-50083614 CAGTGGAGCAGAAGGATAGAGGG - Intergenic
1082788447 11:57330628-57330650 CAGTGGGGCTGGGAGAGGGAGGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082914609 11:58418802-58418824 CAGTGGCGCTAGAGGAATTAAGG - Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083913027 11:65720976-65720998 GAGAGGGGAGGGAGGAAAGAGGG - Intergenic
1084172367 11:67406705-67406727 CATGGGGGCTGGAGGAAGGAGGG + Intronic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085201337 11:74703996-74704018 CAGTGGGGATGAAGTAGAGAAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085323919 11:75592331-75592353 CATTGGGGCTGCAGGCAAGGAGG - Intronic
1086325577 11:85695379-85695401 CATTGGGGGTAGGGGAAAGAGGG + Intronic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087727342 11:101736956-101736978 CAGTGGGGGTGGGTGAAGGAAGG + Intronic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1088851300 11:113705597-113705619 CAGTGAGGCTGCAGGACAGCAGG + Intronic
1088928107 11:114322584-114322606 GAGTGGGGCTCGAGGAAACCTGG + Intergenic
1088971840 11:114780765-114780787 CATTTGGGCAGGTGGAAAGATGG + Intergenic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089492951 11:118895077-118895099 CAGGTGGGCAGGAGGAGAGAGGG - Exonic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091026022 11:132141974-132141996 CATTGAAGCTGGAGGACAGAAGG + Intronic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091181041 11:133605041-133605063 CACTGTGCCTGGAAGAAAGAGGG + Intergenic
1091534338 12:1391418-1391440 CAGTGGGGGTGAAGGAAGGGGGG + Intronic
1091695944 12:2628109-2628131 CAGTCAGGCTGGTGGCAAGAAGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092902202 12:13070508-13070530 CACTTGGGCTGGAGGAAATTGGG + Intronic
1095400838 12:41813592-41813614 CAGGGGAGTGGGAGGAAAGATGG + Intergenic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096271217 12:50167475-50167497 AAGTGGGCCGGGAGGAGAGATGG - Intronic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1096804542 12:54132464-54132486 CAGGGAGGCTTGAGGAAGGAGGG - Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097246624 12:57610968-57610990 CCCGGGGCCTGGAGGAAAGAAGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1100526573 12:95425145-95425167 CAGAGAGGCTGGAGGAAACGGGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101139874 12:101784264-101784286 AAGTGGGGCTGGACGAAGCAGGG + Intronic
1102216783 12:111167228-111167250 CAGTGCAGGTGAAGGAAAGAAGG - Intronic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1102815515 12:115862267-115862289 AAGTGAGGGTGGAGGAGAGAGGG + Intergenic
1103261751 12:119594392-119594414 CACTGGGGCTCTAGAAAAGAGGG - Intronic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103568662 12:121830051-121830073 CAGTTGGGCTGCAGGCAAGGTGG - Exonic
1103707867 12:122888958-122888980 CAGTGGGGGTGCAGGAGGGAGGG - Intronic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104383787 12:128331084-128331106 CTGGGGGGCAGGGGGAAAGAGGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106182495 13:27381237-27381259 CAGCGGGGCTGGGATAAAGAAGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1107933040 13:45322095-45322117 TAGTGGGGCTAGAGCAAAGCAGG + Intergenic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1108462867 13:50684593-50684615 CAATGGGCCGGGAGGAAGGAAGG + Intronic
1109143370 13:58745306-58745328 CAGTGAGGGTGGGGGAAAGTAGG + Intergenic
1109184846 13:59255702-59255724 AAGTGGGGAGTGAGGAAAGAAGG + Intergenic
1109838705 13:67893532-67893554 CATTGGCACTGGAGGAATGAAGG + Intergenic
1110136265 13:72071048-72071070 CAGAAGAGCTGGAGGATAGAAGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113193576 13:107778756-107778778 GAGTGGGGAGGGAAGAAAGAGGG - Intronic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1113756126 13:112812369-112812391 CAGTGGGGCTGCACGAGGGAGGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116941767 14:50797956-50797978 GAGCTGGGGTGGAGGAAAGAAGG + Intronic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118882949 14:69843972-69843994 CAGTGGAGCTGGGGAAGAGAAGG + Intergenic
1118890646 14:69905657-69905679 TAGTGGGGTTGAAGAAAAGAAGG + Intronic
1118909229 14:70047400-70047422 CAGAGGGGAGGGAGGAAATATGG - Intronic
1118988888 14:70780262-70780284 TTGTTGGGCTGGAGGATAGAAGG + Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119182417 14:72613966-72613988 GAGTGGGGCAGGGGGAAGGAGGG - Intergenic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1119537942 14:75418292-75418314 CAGTGGGTCTGGAAGAATTATGG + Intergenic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120924776 14:89787085-89787107 CAGTGCGGCTGGAATAAAGCAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122659157 14:103282828-103282850 CACTGGGGATGGAGGATGGAGGG + Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124712740 15:32029511-32029533 CCCGGGGGCTGCAGGAAAGAAGG + Intergenic
1124803680 15:32860097-32860119 CAGGAGGGAGGGAGGAAAGAAGG + Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1125979367 15:43985951-43985973 CAGTGGGCCTGAAGGAATGCAGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126493563 15:49265706-49265728 TACTGGGGCAGGAGCAAAGATGG - Intronic
1126575727 15:50194412-50194434 CAATGTGGTTAGAGGAAAGAGGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1127977646 15:64009967-64009989 CAGTTGGGCTGTGGGTAAGAGGG + Intronic
1128056328 15:64702729-64702751 CGGTGGGGCTGAAAGAAAAAAGG + Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129646231 15:77436338-77436360 CAGTGGAGATGTAGCAAAGAGGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130962512 15:88672059-88672081 GAGTGGGGAGGAAGGAAAGATGG + Intergenic
1131616005 15:94018033-94018055 GATTGGAGCTGGAGGAGAGAGGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133427666 16:5706818-5706840 CACTGGGGCAGGGGGCAAGAGGG + Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135924172 16:26677665-26677687 GAGTGGGGTTCAAGGAAAGAAGG - Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136536635 16:30903398-30903420 CAGAGGGGCTGAAGGAAAGGAGG - Exonic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138089916 16:54165545-54165567 CCGCGGGGCTGAAGGACAGAAGG + Intergenic
1138238743 16:55408923-55408945 CAGTGAGGGAGGAGGAAAGCAGG - Intronic
1138414122 16:56861544-56861566 CAGTGGGGCTGAAGGCTTGAGGG - Intergenic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141181595 16:81756593-81756615 CAGAGGTGGTGGGGGAAAGAAGG + Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141498823 16:84429626-84429648 CAGTGGGGATGGAGAATCGATGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142153357 16:88522329-88522351 AGGGTGGGCTGGAGGAAAGACGG + Intronic
1143370718 17:6437301-6437323 CCGTGTGGCTGGAGAAAGGATGG - Intergenic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144150395 17:12437648-12437670 CAGTGGGGGTGGGGGAAATGGGG - Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144962301 17:19051720-19051742 GAGTGGGGCTGGGTGCAAGAAGG - Intergenic
1144972860 17:19122800-19122822 GAGTGGGGCTGGGTGCAAGAAGG + Intergenic
1145254693 17:21316212-21316234 GACTGGGGCTGGAGGACAGGAGG - Intergenic
1145321904 17:21771753-21771775 GACTGGGGCTGGAGGACAGGAGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146792611 17:35760957-35760979 GAGTGGGGCTGGAGGCAGGGTGG + Intronic
1147153682 17:38532656-38532678 AAGTGGGCCTGGAGTAGAGACGG - Exonic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147759058 17:42785766-42785788 AAATGGGGAGGGAGGAAAGAAGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148318118 17:46722291-46722313 GACTGAGGCTGGAGGTAAGAAGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1150631233 17:66881822-66881844 AAATGGGCCTGGAGGAAAGTGGG + Intronic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1153178209 18:2403625-2403647 CCCTGGGGCTGGAAGAAAAAGGG - Intergenic
1153299805 18:3582829-3582851 GAGGGGGGAGGGAGGAAAGAAGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156511139 18:37637784-37637806 CAGGAGAGTTGGAGGAAAGAGGG + Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157574792 18:48736383-48736405 CAGTGCAGCTGGAGGAAGAAGGG - Intronic
1157671233 18:49530513-49530535 CAGTGGCGCTAGAGGAATTAAGG + Intergenic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1158514656 18:58120854-58120876 CAGTGGGGATGGGGGAGTGAGGG - Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160131745 18:76231492-76231514 CCCTGAGGCTGGAGGTAAGAAGG - Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162946834 19:14049087-14049109 GAGTGGGGCTGGAGGATGGGGGG + Intronic
1163550888 19:17966072-17966094 CAGTTGGACTGAAGGAAGGAAGG - Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1164296667 19:23916175-23916197 CAGTCAGGCTGGAGGAATAAGGG - Intronic
1164401553 19:27905515-27905537 CAGTGGGGAGGCAGGAGAGAAGG - Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164563154 19:29308004-29308026 CACTGAGGCTTGAGGAAGGATGG - Intergenic
1164609130 19:29620488-29620510 CAGGGAGGCAGGAGGAAAGTTGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165311042 19:35029838-35029860 GAGTGGAGTGGGAGGAAAGAGGG + Intergenic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167710390 19:51106999-51107021 CAGATGGGCTGGATGAAAGGTGG - Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1167946363 19:52992312-52992334 GAGTGGTGCTGGTGGCAAGAGGG - Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928656627 2:33458715-33458737 CAATGGTGCTGGTGGAAAAAGGG - Intronic
928762917 2:34605825-34605847 AAGTGGGGCAGAAGGACAGAAGG + Intergenic
929020691 2:37549683-37549705 CAGGGTGGCTGAAGGAAACATGG - Intergenic
929087035 2:38178534-38178556 GAGCGGGGCTGTAGGAGAGAAGG + Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930231034 2:48843976-48843998 CACTGGGGTAGGAGGAAGGATGG + Intergenic
930312251 2:49755951-49755973 AAGTGGGGAAGGGGGAAAGAAGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931632670 2:64315520-64315542 GAGTTGGCCAGGAGGAAAGATGG + Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932485622 2:72082664-72082686 CAGTAGGGGTGGCGAAAAGATGG - Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932743811 2:74314439-74314461 AAGTGGGGCTGGGGTAACGATGG + Intronic
933024543 2:77238517-77238539 TAGTGTGGTTTGAGGAAAGAGGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
933879024 2:86649349-86649371 CAGTCTGGCTGGTGGTAAGAGGG - Intronic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935190434 2:100773722-100773744 CACTGGGGCTGCAGGAGGGATGG - Intergenic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
935708107 2:105873634-105873656 CAGTGAGGCTGGGGGAAGGGTGG + Intronic
936919561 2:117673897-117673919 CTGTGGGGCAGAAGGAAATAGGG + Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938601999 2:132851711-132851733 CTGTCGGGCTGCAGGAAGGAAGG - Intronic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
939532517 2:143382149-143382171 CACTGAGGCTGGTGGAAGGAAGG - Intronic
940159552 2:150696840-150696862 CAGGAGGGAGGGAGGAAAGAAGG + Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941347467 2:164388208-164388230 GAGTGAGGCTGGTGGAGAGAAGG - Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941773346 2:169365353-169365375 CAATGGGGGTGGAAAAAAGAAGG - Intergenic
942758429 2:179369355-179369377 CAGTAGGGATGGAGGACCGAGGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943452887 2:188067224-188067246 AAGTCATGCTGGAGGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
944480451 2:200152462-200152484 CAGTGGCGCTAGAGGAATTAAGG - Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
947102296 2:226634104-226634126 AAGTGCAGCAGGAGGAAAGATGG - Intergenic
947212993 2:227724887-227724909 CAGGGAAGCTGGAGGAAACAAGG - Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169956925 20:11114012-11114034 CAGATGGGGTGGAGCAAAGAAGG - Intergenic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171183366 20:23107492-23107514 CCATGGGGCTGCAGGAAGGAAGG + Intergenic
1171201580 20:23246204-23246226 TAGTGGGTCAGGATGAAAGAGGG - Intergenic
1171338094 20:24405860-24405882 CAGGTGGGCTGGTGGTAAGAAGG - Intergenic
1171424699 20:25042267-25042289 GCCTGGGGCTGGAGGAAAGGTGG + Intronic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173446683 20:43125343-43125365 CAGTGTGGGTGGTAGAAAGAGGG - Intronic
1173844811 20:46181462-46181484 CTTTGTGGCTGGAGGAATGAGGG + Intronic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174065206 20:47859808-47859830 CAGTGAGGCTGGAGGCAGCAGGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174486579 20:50865269-50865291 GGGAGGGGCAGGAGGAAAGAGGG + Intronic
1174744286 20:53046133-53046155 CAAGGGGGCTGCAGGCAAGAGGG + Intronic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175665432 20:60854604-60854626 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1175723863 20:61303654-61303676 CAATGGCGCTGGAGGTGAGAAGG - Intronic
1175888794 20:62306977-62306999 CGGTGGGGCTGGAGGACTGGAGG + Intronic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1177633184 21:23752714-23752736 CAGTGGGCCTCTAGGAATGATGG + Intergenic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1178222952 21:30681653-30681675 AAGTGGGGCTGTACCAAAGAAGG + Intergenic
1178668545 21:34569958-34569980 CAAAGGGGCTGGAGGAAGGGAGG + Intronic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179530172 21:42012908-42012930 GAGTGGAGGTGGGGGAAAGATGG - Intergenic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1180859795 22:19071215-19071237 TAGTGGTGCTGGAGGCAGGAGGG - Intronic
1181544256 22:23592102-23592124 CAATGGGGCTGGAGCATGGAGGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1182926706 22:34131904-34131926 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183526737 22:38327564-38327586 GAGTGGAGCAGGAGGACAGAGGG - Intronic
1183664881 22:39241573-39241595 CCGTGGAGCTGTGGGAAAGAAGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184005753 22:41707296-41707318 CACTGGGGCTGGGGGAACAAAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184549699 22:45197941-45197963 CAGATCGGCTGGAGGAAAGAAGG + Exonic
1184796243 22:46735002-46735024 AAGTGGGGTTGGTGGAAGGAAGG + Intronic
1184797938 22:46742548-46742570 CAGAGAGGCTGGAGGAACCAGGG + Intergenic
1184978166 22:48077781-48077803 CAGGGGGGCTGGGGAAGAGAGGG + Intergenic
1184990019 22:48161071-48161093 CAGGCAGGCTGGAAGAAAGAGGG + Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
949244238 3:1906641-1906663 CAGTGGGGGAGTGGGAAAGAGGG - Intergenic
949424669 3:3904089-3904111 CACTGAGGCTTGAGGAAAGCAGG - Intronic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
950903595 3:16517779-16517801 CAGTGGGGGCGGGGGAATGATGG - Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951783506 3:26390749-26390771 CAGTGGGGGAGGAGCCAAGATGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953586761 3:44208029-44208051 CAGTGGGCCTAGAAGAAAGTGGG - Intergenic
954217694 3:49133530-49133552 GAATGGGGCTGGGGGAGAGATGG + Intergenic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959597881 3:108147443-108147465 AACTGGGGCTAGAGGAAGGATGG + Intergenic
959869192 3:111307123-111307145 CATTACGGCTGGTGGAAAGAGGG - Intronic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964792321 3:160463726-160463748 AAGTGGGGCGGGTGGAAAGGAGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965728159 3:171742169-171742191 GACTGGGGTGGGAGGAAAGATGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970088486 4:12374901-12374923 CAGTGGGGCTAGAATAAAGGAGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971067506 4:23050462-23050484 GAGTGGGGTTGGAGTAGAGAGGG + Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972603643 4:40594159-40594181 CAGTGCTGGTGGAGGAAACAGGG - Intronic
973095811 4:46197914-46197936 CAGTGGGGGTAATGGAAAGAAGG - Intergenic
973297299 4:48538873-48538895 CATTGAGTCTGGAGGAAAAAAGG - Intronic
973590612 4:52437060-52437082 GACTGGGGCTGGAGGAAAAGTGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
973676378 4:53268056-53268078 CGGTAGGGCAGGAGGAATGAAGG + Intronic
973809528 4:54556675-54556697 CAATGGGGCTGGACAAATGAAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975099905 4:70501043-70501065 CAGTGGGGCTAGAATAAAGCAGG - Intergenic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
975425868 4:74227007-74227029 CACTGGGGCTGGTGGACAAATGG - Intronic
975938854 4:79615962-79615984 CACTGGGGCTGAGGCAAAGATGG + Intergenic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976050357 4:81004677-81004699 CAATGGGCCTGGAGGAAATGAGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976831057 4:89314424-89314446 CAGTAAGGCTGGGGAAAAGAGGG + Intergenic
977155669 4:93569707-93569729 CAGTGCGGCTGAAGGAAAATGGG - Intronic
977696502 4:99971856-99971878 CAGTGCGGTTGGGGGAAGGATGG - Intergenic
977988057 4:103408653-103408675 CAGTAAGGCTCGAAGAAAGAGGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
979889058 4:126066382-126066404 CAGTGGGGCTAGAACAAAGCCGG - Intergenic
980401054 4:132286498-132286520 CAGTGGGGTTATAGGAAACAAGG - Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981756657 4:148147210-148147232 CACTGGAGATGGAGGAAAGGTGG - Intronic
981836348 4:149058854-149058876 CAATAAGGATGGAGGAAAGAGGG - Intergenic
981903341 4:149891765-149891787 AGTAGGGGCTGGAGGAAAGATGG - Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982284758 4:153723919-153723941 CACTGGGGCTGGGGGAAAAGGGG - Intronic
982806850 4:159776603-159776625 CATTATGGCTGGCGGAAAGAAGG + Intergenic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986599410 5:9456626-9456648 CAAAGGGGCTGGAGGAGAAAAGG + Intronic
986738093 5:10682372-10682394 CAGTGTCGCTGGAGGAAGCATGG + Intronic
986926071 5:12753645-12753667 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
987230514 5:15889086-15889108 AAGTGGGGCGGGGGGAAAGAAGG + Intronic
987503513 5:18743195-18743217 CAGTGGCTCTGAAAGAAAGAAGG - Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
988814955 5:34825659-34825681 CCGTGCTGCTGGAGGAAGGAGGG + Intronic
989234720 5:39133402-39133424 CGGAGGTGTTGGAGGAAAGAAGG + Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992378379 5:76212277-76212299 CAGTGGCTCTGGAGCAATGATGG - Intronic
992955884 5:81907616-81907638 TTCTGGGGCTGGAGGAAACAAGG + Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
995015027 5:107300256-107300278 CAAGGGAGTTGGAGGAAAGAAGG + Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995696849 5:114888356-114888378 CAGTGAGGCTGTAGAAAAAAAGG + Intergenic
995766220 5:115622666-115622688 CAATGGGGAATGAGGAAAGATGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
997208954 5:132066600-132066622 GAGAGGTGCTGGAGGAAATAGGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998369868 5:141654030-141654052 CAGTGGGGCTGGGGGATTGGGGG + Exonic
999138203 5:149337966-149337988 CAGAGCAGCTGGAGCAAAGAGGG + Intronic
999418972 5:151424327-151424349 CAGTGATGCTGGAGGAAGAAAGG + Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
1000205017 5:159050534-159050556 CAGGGGAGCTGGAGAAAGGAGGG - Intronic
1000694348 5:164361266-164361288 AAGTGGGGCTGGAAGAAAAGGGG + Intergenic
1000903728 5:166937717-166937739 GAGAGGGGAAGGAGGAAAGAAGG + Intergenic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1002587151 5:180256403-180256425 CAGGGGGGCAGGGGGCAAGAGGG + Intronic
1002856829 6:1045317-1045339 CATAGGGGCTGGAGGAAAATGGG + Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1004251227 6:14024640-14024662 GAGTGGGGCTTGGGGAAAGTAGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1006104973 6:31710965-31710987 CAGTGGAGCTGAAGGACAAATGG + Intronic
1006363293 6:33599561-33599583 CCTGGGGGCTGGAGGAATGATGG - Intergenic
1006380501 6:33694552-33694574 CAGGCGGGCGGGAGGAAGGAAGG + Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007741252 6:44010897-44010919 CAGTGGGGCTGCTGGAGACAGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008405010 6:51109339-51109361 CAAAGGGGCTGGAGGAATTATGG + Intergenic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1009694965 6:67090510-67090532 GACAGGGGTTGGAGGAAAGAAGG - Intergenic
1010981455 6:82374848-82374870 CAGTGGGCCTGGAAGAAGGGTGG + Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013306458 6:108851228-108851250 CACTGGAGCTGGAGTAGAGAAGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014781824 6:125573593-125573615 CGGTGGTGCTTGAGGAAAGGGGG - Intergenic
1015391610 6:132688838-132688860 CCAAGGTGCTGGAGGAAAGAGGG - Intronic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016355362 6:143212367-143212389 CAGGGAGGCTGGGGTAAAGAAGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017424409 6:154305731-154305753 CAGTGGAGCTGGAATAAAGCAGG + Intronic
1017988887 6:159469334-159469356 CAGTGGGGCTGATGCACAGATGG - Intergenic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019398360 7:835858-835880 CAGGGGGGCTGGAGACATGAGGG + Intronic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021108346 7:16665577-16665599 CAGTGAGGCTGGGGGAAACAGGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021307096 7:19045616-19045638 CAGAGGGGCAGGGGAAAAGATGG - Intronic
1021401285 7:20212540-20212562 GAGTGGGGCAGGAGGAAAAGCGG + Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023560856 7:41471816-41471838 CAGTGGTGATGGAGGACATATGG + Intergenic
1023812701 7:43924726-43924748 CAGGTGGGCTGGAGGTAGGAAGG + Intronic
1025688403 7:63739014-63739036 CAGTGGAGCAGAAGGATAGAAGG + Intergenic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1026795516 7:73363908-73363930 CAGTGTTGCTGGGGGAATGAAGG - Intergenic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027162967 7:75815570-75815592 CACTGAGGTTGGAGGACAGAAGG + Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030634837 7:111937018-111937040 CAGTGGGGAAGAAAGAAAGATGG + Intronic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032538473 7:132684194-132684216 GGGTGGGGCTGGAGGAATAAGGG + Intronic
1033172313 7:139095026-139095048 CAGAGGGGATGAAGGAGAGAAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034445784 7:151113571-151113593 GACTGGGGGTGGAGGAAAGTGGG + Intronic
1034548973 7:151808397-151808419 CAGTTGGACTGTAGGCAAGAAGG + Intronic
1034785158 7:153919368-153919390 CAGAGGGCCTGAAGGAAAGCTGG + Intronic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035332588 7:158105981-158106003 CAGTGGAGCTGGATGAAGGAGGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035784621 8:2250902-2250924 CAGTGGGGCTGCATTAACGATGG + Intergenic
1035808186 8:2470811-2470833 CAGTGGGGCTGCATTAACGATGG - Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037604045 8:20422588-20422610 AACTGGGGCTGGAGGAAATGGGG - Intergenic
1037605454 8:20434222-20434244 CAGAGGGGCGGGGGGAGAGAAGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039592003 8:38757232-38757254 CGGTGGGGCGGGAGGAAGGGTGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045414540 8:101952976-101952998 CCGTGGGGATGAAGGAAAGGAGG - Intronic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048148872 8:131873407-131873429 CAATGGGGTTGAAGCAAAGAAGG + Intergenic
1048251514 8:132869985-132870007 CAGTGGCCCTGCAGGAAATAGGG - Intronic
1048306742 8:133289802-133289824 CAGTGGGGCAGCAGGAACGCTGG + Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048934195 8:139341804-139341826 CAGGTGGGCTGGAGGCTAGAGGG - Intergenic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049272397 8:141702883-141702905 GAGAGGGGAAGGAGGAAAGAAGG - Intergenic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049611506 8:143558249-143558271 CAGGCGGGCTGGCGGGAAGAGGG + Intronic
1050098844 9:2096936-2096958 CATTGGGGCAGGAAGAAAGAAGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1051102061 9:13532934-13532956 GAGAGGAGCTGGAGGAATGAGGG + Intergenic
1052319326 9:27150690-27150712 CAGTGGGGGTGCAGGAAGCATGG - Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052977712 9:34423756-34423778 CAGTGGGGTTGGAAAAAAGGAGG + Intronic
1053467110 9:38316636-38316658 CAATGTGGCTGCAGGAAGGATGG + Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1054906588 9:70418915-70418937 AAGTGGGGCGGGAGCAAAGTAGG - Intergenic
1055774076 9:79749102-79749124 CAGTGGGGCTGGAATTAACAAGG + Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058908404 9:109499119-109499141 CAGTGGAGTTTGGGGAAAGAGGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059802893 9:117768591-117768613 CAATGGGGATGGGGAAAAGACGG + Intergenic
1059819450 9:117956069-117956091 CAGTGGGGCAGGAGAATAGGGGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060235466 9:121859701-121859723 CAGATGGGCTGGAGCAAAAAGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061235018 9:129337129-129337151 GAGTCGGGCTGGAGGCAGGAGGG + Intergenic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062335903 9:136067310-136067332 CAGTGGGGGTGGGGGAGGGATGG + Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186313128 X:8341649-8341671 CACTGGGGGTGAAAGAAAGAAGG - Intergenic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187319334 X:18226280-18226302 CAGGGGAGCTGGAGGAGGGAAGG + Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187704564 X:21996918-21996940 CAGCGGGGCTAGAGGAAGGCTGG + Intergenic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189227221 X:39422961-39422983 CAGTGGTGGAGGTGGAAAGAAGG - Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192432098 X:71119290-71119312 GAGTAGGGCAGGAGAAAAGAAGG - Intronic
1192660583 X:73037818-73037840 CCGGGGGGCTGGAGCCAAGATGG - Intergenic
1193916025 X:87364830-87364852 CAGTAGCGCTGGAGGAATTAAGG - Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195399467 X:104446264-104446286 CAAAGGGGCTGAAGGAAAGAGGG + Intergenic
1195407136 X:104527167-104527189 CAGTGGGTCTGGTTTAAAGATGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196290179 X:113930623-113930645 TACGGGGGCTGGAGGAAGGAGGG - Intergenic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1200015415 X:153158767-153158789 CAATGGTGCTGGAAGATAGATGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic
1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG + Intergenic
1202140177 Y:21713463-21713485 CAGTGGTGCTAGAGGAATTAAGG - Intergenic
1202306214 Y:23473688-23473710 CAGTGTGGAAGGGGGAAAGATGG + Intergenic
1202564595 Y:26196901-26196923 CAGTGTGGAAGGGGGAAAGATGG - Intergenic