ID: 1077828720

View in Genome Browser
Species Human (GRCh38)
Location 11:5839415-5839437
Sequence TCACTACCCTTTACAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1166
Summary {0: 1, 1: 1, 2: 18, 3: 194, 4: 952}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077828720_1077828727 0 Left 1077828720 11:5839415-5839437 CCACAGGCTGTAAAGGGTAGTGA 0: 1
1: 1
2: 18
3: 194
4: 952
Right 1077828727 11:5839438-5839460 GGAGGGCAGGATAGAGGGATTGG 0: 1
1: 0
2: 5
3: 113
4: 1207
1077828720_1077828729 29 Left 1077828720 11:5839415-5839437 CCACAGGCTGTAAAGGGTAGTGA 0: 1
1: 1
2: 18
3: 194
4: 952
Right 1077828729 11:5839467-5839489 GGTACAAAAATACAGTTACAAGG 0: 3
1: 42
2: 118
3: 220
4: 545
1077828720_1077828726 -5 Left 1077828720 11:5839415-5839437 CCACAGGCTGTAAAGGGTAGTGA 0: 1
1: 1
2: 18
3: 194
4: 952
Right 1077828726 11:5839433-5839455 AGTGAGGAGGGCAGGATAGAGGG 0: 1
1: 0
2: 7
3: 82
4: 1319
1077828720_1077828725 -6 Left 1077828720 11:5839415-5839437 CCACAGGCTGTAAAGGGTAGTGA 0: 1
1: 1
2: 18
3: 194
4: 952
Right 1077828725 11:5839432-5839454 TAGTGAGGAGGGCAGGATAGAGG 0: 1
1: 0
2: 0
3: 39
4: 399
1077828720_1077828728 8 Left 1077828720 11:5839415-5839437 CCACAGGCTGTAAAGGGTAGTGA 0: 1
1: 1
2: 18
3: 194
4: 952
Right 1077828728 11:5839446-5839468 GGATAGAGGGATTGGTTAATAGG 0: 1
1: 0
2: 2
3: 49
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077828720 Original CRISPR TCACTACCCTTTACAGCCTG TGG (reversed) Intronic
900037374 1:427459-427481 CCACTACCCTTCACAGCCTCTGG - Intergenic
900059004 1:663200-663222 CCACTACCCTTCACAGCCTCTGG - Intergenic
900485059 1:2918699-2918721 TCACTGCCCTTAACAGCACGTGG - Intergenic
900863628 1:5251547-5251569 CCACTACCCTTCCCAGCCTCTGG + Intergenic
902144809 1:14389692-14389714 TGACTACCCTTCCCAGCCTCTGG - Intergenic
903373662 1:22852645-22852667 TCACCAGCCTTTACAGACTGTGG + Intronic
904171814 1:28596699-28596721 CCACTACCCTTCCCAGCCTCTGG + Intronic
904921521 1:34011873-34011895 TCACAACCCTTCCCAGCCTCTGG + Intronic
905096707 1:35478248-35478270 ACACTACCCTTCGCAGCCTCTGG - Intronic
905123492 1:35700894-35700916 TCACTAACCTATACAGTCCGTGG - Intergenic
905288039 1:36898114-36898136 CCACTACCCTTCCCAGCCTCTGG - Intronic
905485679 1:38294352-38294374 TCACTACCCTTCCTAGCCTCTGG + Intergenic
906313941 1:44774213-44774235 CCACTACCCTTTCTAGCCTCTGG - Intergenic
906334895 1:44920540-44920562 TCTCTACCCTTTCCAGCCTCTGG + Intronic
906426564 1:45718837-45718859 ACACTACCCTTCCCAGCCTCTGG - Intronic
906812218 1:48839560-48839582 CCACTAACCTTTCCAGCCTCTGG - Intronic
906871418 1:49485810-49485832 CCACTACCCTTCCCAGCCTGTGG - Intronic
907614435 1:55909888-55909910 TCACTACCCTTCCCAGCCTCTGG - Intergenic
908114873 1:60930637-60930659 CCATTACCCTTTCCAGCCTCTGG - Intronic
908464340 1:64376721-64376743 TCACTACCCTTCCCAGCCTCTGG + Intergenic
909334367 1:74454372-74454394 CCACTACCCTTCCCAGCCTCTGG + Intronic
909431601 1:75593823-75593845 TGACTACCCTTCTCAGCCTTTGG - Intronic
909855346 1:80522608-80522630 CCACTACCCTTCTCAGCCTCTGG - Intergenic
910102034 1:83587765-83587787 CCACTACCCTTCCCAGCCTCTGG + Intergenic
910183553 1:84510997-84511019 CCACTACCCTTCCCAGCCTCTGG - Intergenic
910547840 1:88439282-88439304 CCACTACCCTTCCCAGCCTCTGG - Intergenic
910819727 1:91333443-91333465 CCACTACCCTTCCCAGCCTCTGG - Intronic
910916391 1:92293946-92293968 CCACTACCATTTTCAGCCTCTGG - Intronic
910991194 1:93058356-93058378 CCACTACCCTTCCCAGCCTCTGG - Intergenic
911012367 1:93294599-93294621 CCACTACCCTTCCCAGCCTCTGG - Intergenic
911470396 1:98310981-98311003 CCACTACCCTTCCCAGCCTCTGG - Intergenic
911487692 1:98523053-98523075 CCACTACCCTTTTCAGCCACTGG - Intergenic
911698121 1:100916760-100916782 ACACTACCCTTCCCAGCCTCTGG + Intronic
911897230 1:103452084-103452106 TAAGTTCCCCTTACAGCCTGGGG - Intergenic
911942496 1:104065548-104065570 TAACTACCCTTCTCAGCCTCTGG + Intergenic
912061729 1:105681100-105681122 TTACTACCCTTCTCAGCCTCTGG - Intergenic
912136727 1:106669158-106669180 TCACTACACTTTCCAGCTTCTGG - Intergenic
912150115 1:106848482-106848504 CTACTACCCTTTCCAGCCTCTGG - Intergenic
912312993 1:108641753-108641775 TAACTACCCTTCCCAGCCTCTGG - Intronic
912502104 1:110129634-110129656 TGACTAGCCCTTGCAGCCTGTGG + Intergenic
912503585 1:110139563-110139585 TCTCTACCCTTCCCAGCCTCTGG + Intergenic
912644369 1:111378023-111378045 TGACTACCCTTCCCAGCCTCTGG - Intergenic
912898735 1:113623855-113623877 TAACTACCCTTCCCAGCCTCTGG + Intronic
913166141 1:116187556-116187578 CCACTACCCTTCCCAGCCTCTGG + Intergenic
913396150 1:118375103-118375125 TCACTTCTCTATACAGCCTTGGG + Intergenic
914970011 1:152300273-152300295 TCATTACCCTTCCCAGCCTCTGG - Intergenic
915105069 1:153529144-153529166 CCTCTACCCTTCCCAGCCTGTGG - Intergenic
916322505 1:163520771-163520793 TGACTACCCTTCCCAGCCTCTGG - Intergenic
916334911 1:163660095-163660117 TCACTACCCTTCCCAGCCTCTGG + Intergenic
916736021 1:167607754-167607776 CCCCTGCCCTTTGCAGCCTGGGG + Intergenic
916768482 1:167884627-167884649 CCACTACCCTTCCCAGCCTTTGG + Intronic
917258124 1:173138440-173138462 CCACTACCCTTCCCAGCCTCTGG - Intergenic
917364595 1:174216132-174216154 CCACTACCCTTTTCAGCTTCTGG - Intronic
917383612 1:174442873-174442895 TCCCTACCCTTCCCAGCCTCTGG + Intronic
917402869 1:174670548-174670570 CAACTACCCTTTTCAGCCTCTGG + Intronic
917794520 1:178522951-178522973 TGACTACCCTTCCCAGCCTCTGG + Intronic
918027751 1:180769422-180769444 CCACTACCCTTCCCAGCCTCTGG + Intronic
918090248 1:181286308-181286330 TCACTACCCTTCCCAGCCTCTGG - Intergenic
918270520 1:182893861-182893883 CCACTACCCTTGCCAGCCTTTGG - Intergenic
918401517 1:184167501-184167523 ACACTACCCTTCCCAGCCTCTGG + Intergenic
918475720 1:184922393-184922415 CCACTACTCTTTCCAGCCTCTGG + Intronic
918621260 1:186608609-186608631 GCAATACCCGTTAAAGCCTGAGG - Intergenic
918671147 1:187217863-187217885 TCACTACCCTTCATGGCCTCTGG + Intergenic
919177235 1:194033815-194033837 TCACTGCCCTTCACACCCTCAGG - Intergenic
919223912 1:194668748-194668770 TCACTACCCTTTTTAGCCTCTGG - Intergenic
919265321 1:195256010-195256032 CCACTACCCTTCCCAGCCTCTGG - Intergenic
919348410 1:196416924-196416946 CCACTACCCTTCCCAGCCTCTGG + Intronic
919585992 1:199440947-199440969 TCACTACCCTTCCCAGCCTTTGG - Intergenic
920714112 1:208323368-208323390 TCCCTATTCTTTACAGCCTGTGG + Intergenic
920853663 1:209646522-209646544 TCACTAACCATGACCGCCTGTGG + Intronic
921878459 1:220226327-220226349 TCAATTCCCTTTACAGCATAAGG + Intronic
921904231 1:220479356-220479378 CCACTACCCTTCCCAGCCTCTGG + Intergenic
921949467 1:220914699-220914721 CCACTACCCTCACCAGCCTGCGG - Intergenic
922014009 1:221624275-221624297 CCACTACCATTTCCAGCCTCTGG + Intergenic
922407492 1:225330647-225330669 CCACTACCCTTCCCAGCCTCTGG - Intronic
923691234 1:236195262-236195284 CCACTACCCTTCCCAGCCTCTGG + Intronic
923824271 1:237482353-237482375 CCACTACCCTTCCCAGCCTCTGG + Intronic
924767350 1:247046369-247046391 TCACTGCCCTGTGCAGCCTCAGG + Intronic
1063518691 10:6721425-6721447 GCAGGACCCTTTGCAGCCTGAGG + Intergenic
1063974273 10:11402758-11402780 TTACTACACTTTCCAGCCTGTGG - Intergenic
1064259378 10:13772794-13772816 TCACTACCCTTTCCAACCTCTGG - Intronic
1064331479 10:14398249-14398271 TCACTAACCTTCCCAGCCTCTGG - Intronic
1064699277 10:18001989-18002011 CCACTACCCTTCCCAGCCTCTGG + Intronic
1064819343 10:19308181-19308203 CCACTACCTTTTCCAGCCTCTGG + Intronic
1064822580 10:19354527-19354549 CCACTACCCTTTCCAGCCTCTGG + Intronic
1064899460 10:20277841-20277863 TCACTACCCTTCCTAGCCTCTGG + Intronic
1064955907 10:20909296-20909318 CCACTACCCTTTCCAGTCTCTGG + Intronic
1065197692 10:23282906-23282928 TCACTACCCTTCCCAGCATCTGG - Intronic
1065426457 10:25609464-25609486 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1065609052 10:27452697-27452719 TCACCACCCTTTCTAGCCTCAGG + Intergenic
1065907143 10:30266282-30266304 TCACTACCCTTCTCAGCCTCTGG - Intergenic
1066124139 10:32322818-32322840 CCACTACCCTTCCCAGCCTTTGG - Intronic
1066178223 10:32933060-32933082 TCACTACCCTTCCCAGCCTCTGG + Intronic
1066485482 10:35838826-35838848 CCACTACCCTTCGCAGCCTCTGG + Intergenic
1067066289 10:43105899-43105921 TCACAACCCCCTCCAGCCTGGGG + Intronic
1067160641 10:43822063-43822085 TCACCACACTTTGCAGCCTGTGG - Intergenic
1067253490 10:44610457-44610479 TCACCACCCTTCCCAGCCTCTGG + Intergenic
1068451062 10:57189263-57189285 TCACTACTCTTCCCAGCCTCTGG + Intergenic
1068506336 10:57904541-57904563 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1068607096 10:59017667-59017689 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1068660163 10:59615219-59615241 TCGCTACCCTTCCCAGCCTTTGG - Intergenic
1068709762 10:60121311-60121333 TCACTACCCTTCCCAGCCTCTGG - Intronic
1069052087 10:63805932-63805954 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1069193000 10:65513253-65513275 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1069397299 10:68003515-68003537 CCACTACCCTTCCCAGCCTCTGG + Intronic
1070848882 10:79546473-79546495 TCTCTACCCTCTTCAGCCAGGGG - Intergenic
1070924909 10:80213717-80213739 TCTCTACCCTCTTCAGCCAGGGG + Intergenic
1070970755 10:80565319-80565341 CCACTACCCTTCCCAGCCTCTGG + Intronic
1071088543 10:81892657-81892679 TCACTACCCTTCTCAGTCTCTGG - Intronic
1071196959 10:83172651-83172673 CAACTACCCTTCACAGCCTCTGG + Intergenic
1071256015 10:83872302-83872324 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1071326172 10:84520562-84520584 CCACCACCCTTTCCAGCCTTTGG + Intergenic
1071386001 10:85121889-85121911 TCACTACCCTATACCGTGTGAGG - Intergenic
1071878391 10:89867284-89867306 TGACTACACTTTTCAGCCTGTGG + Intergenic
1071970225 10:90898079-90898101 CCACTACCCTTCCCAGCCTCTGG + Intronic
1072114539 10:92357531-92357553 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1072863408 10:99030973-99030995 TCACTACTCTTTTCAGCCTCTGG - Intronic
1073861824 10:107752654-107752676 GCACTACCCTTCCCAGCCTCTGG - Intergenic
1073995127 10:109306967-109306989 TCACCACTCTTTACAGCCTCTGG - Intergenic
1073998887 10:109347156-109347178 CCACTACCCTTTCCAGACTCTGG + Intergenic
1074017916 10:109553370-109553392 CCGCTACCCTTTCCAGCCTCTGG + Intergenic
1074425175 10:113344409-113344431 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1074620710 10:115117353-115117375 CCACTACCCTTCCCAGCCTCTGG + Intronic
1075223786 10:120607076-120607098 CCACTACCCAGTAGAGCCTGTGG - Intergenic
1075306294 10:121370595-121370617 TAACTCCCCTTTCCACCCTGGGG - Intergenic
1076964100 11:65382-65404 CCACTACCCTTCACAGCCTCTGG - Intergenic
1077054657 11:585204-585226 ACACTGCCCTTTCCAGCTTGAGG + Intronic
1077428841 11:2504316-2504338 CCACTACCCTTCCCAGCCTCTGG - Intronic
1077696172 11:4394630-4394652 CCACTACCCTTCCCAGCCTTTGG + Intergenic
1077741081 11:4846391-4846413 CCACTACCCTTCCCAGCCTCTGG - Intronic
1077823265 11:5773911-5773933 TCACTACACTTGCCAGCCTCTGG + Intronic
1077828720 11:5839415-5839437 TCACTACCCTTTACAGCCTGTGG - Intronic
1077872889 11:6278304-6278326 CCAATACCCTTCACAGCCTCTGG - Intergenic
1078750707 11:14159876-14159898 CCACTACCCTTCCCAGCCTCTGG - Intronic
1078985465 11:16590794-16590816 TGACTACCCTTCCCAGCCTCTGG - Intronic
1079010488 11:16824096-16824118 CCACTACCCTTCCCAGCCTCTGG - Intronic
1079166553 11:18049491-18049513 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1079186136 11:18238817-18238839 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1079677978 11:23256008-23256030 TCACTACCCTTCCCAGCCTGTGG - Intergenic
1079707815 11:23642581-23642603 CCACTACCCCTTCCAGCCTCTGG - Intergenic
1079813764 11:25029071-25029093 CCACTACCCTTCCCAGCCTCTGG - Intronic
1079820190 11:25117089-25117111 TCTCTACCATTTACTGCCTTTGG + Intergenic
1079872864 11:25822167-25822189 CCACTACCCTGTGCAGCCTCAGG + Intergenic
1080192784 11:29571259-29571281 CCACTACCCTGCACAGCCTCAGG - Intergenic
1080749185 11:35137306-35137328 TCACTACACTGTACTGCCTGTGG + Intergenic
1080759206 11:35231379-35231401 TCACTACCCCTTTCTCCCTGGGG - Intronic
1081044968 11:38261966-38261988 CCACTACCCTTTCTAGCCTCCGG + Intergenic
1081073185 11:38635437-38635459 CAACTACCCTTCCCAGCCTGTGG + Intergenic
1081364924 11:42222878-42222900 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1082110612 11:48269733-48269755 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1082189194 11:49221932-49221954 ACACTACCCTTTGCAGCCTATGG + Intergenic
1082234295 11:49804117-49804139 TCACTGCCATTTACTGCCTGTGG - Intergenic
1083077232 11:60053696-60053718 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1083085433 11:60138498-60138520 CCCCTGCCCTTTTCAGCCTGTGG - Intergenic
1083177941 11:60964427-60964449 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1083352032 11:62036599-62036621 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1083725977 11:64628474-64628496 TTACTCCCCTTTACAGGCGGGGG + Intronic
1083977986 11:66139499-66139521 CCACTACCCTTCCCAGCCTGTGG + Intronic
1084335189 11:68453380-68453402 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1085365130 11:75934333-75934355 TTACTACCCTTCCCAGCCTCTGG - Intronic
1085553551 11:77398260-77398282 CCACTACCCTTTCCAGCCACTGG + Intronic
1085658001 11:78334405-78334427 TCACTCCCCTTCCCAGCCTCTGG + Intronic
1085675449 11:78513398-78513420 CCACTACCCTTGCCAGCCTCTGG + Intronic
1085749127 11:79144772-79144794 TCACTACCCTTCCCAACCTCTGG - Intronic
1085898778 11:80671713-80671735 CCATTACCCTTTTCAGCCTCTGG + Intergenic
1085991151 11:81846220-81846242 CCACTACCCTTCACAGCCTCTGG - Intergenic
1086007415 11:82053991-82054013 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1086066276 11:82748696-82748718 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1086173498 11:83862432-83862454 CCACTGCCCTTCACAGCCTCTGG - Intronic
1086248862 11:84789725-84789747 TCACTACCCTTCCCAGTCTCTGG + Intronic
1086309964 11:85524074-85524096 TCACTACCCTTCCCAGCTTCTGG - Intronic
1086617290 11:88837305-88837327 TCACTGCCATTTACTGCCTGTGG + Intronic
1086677324 11:89624733-89624755 ACACTACCCTTTGCAGCCTTTGG - Intergenic
1086784321 11:90947492-90947514 TCAATACTCTTCTCAGCCTGGGG - Intergenic
1086962605 11:92994762-92994784 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1087088392 11:94243113-94243135 TGACTACCCTTCCCAGCCTCTGG - Intergenic
1087479759 11:98684487-98684509 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1087708148 11:101519032-101519054 TCAGTACCCTTCCCAGCCTCTGG - Intronic
1088076734 11:105858660-105858682 TCACTATCCTTCCCAGCCTCTGG + Intronic
1088138262 11:106583976-106583998 TCACTACCCTTTCTAGCCTCTGG + Intergenic
1088238004 11:107745674-107745696 CCACTACCCTTCCCAGGCTGTGG - Intergenic
1088643324 11:111895245-111895267 ACACTACCCTTCTCAGCCTCTGG - Intergenic
1089532490 11:119139822-119139844 TCACTACCCTTCCTAGCCTGTGG + Intergenic
1089703374 11:120259282-120259304 TCTCTACCCCTGACAGTCTGTGG - Intronic
1089717542 11:120376796-120376818 CCACTACCCTTCCCAGCCTCTGG + Intronic
1090065022 11:123495559-123495581 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1090137877 11:124217972-124217994 CTACTACCCTTCACAGCCTCTGG + Intergenic
1091598831 12:1904210-1904232 TCGCTACCCTTCCCAGCCTCTGG - Intronic
1091686004 12:2563028-2563050 CCACTACCCTTTCCAGCTTCTGG + Intronic
1092950039 12:13493630-13493652 CCACTACCCTTTCCAGACTCTGG + Intergenic
1093060865 12:14601837-14601859 CCACTACCCTTTCCAGCCTTTGG + Intergenic
1093123737 12:15303649-15303671 TTACTACCCTTCCCAGCCTCTGG - Intronic
1093246619 12:16746075-16746097 CAACTACCCTTTCCAGCCTCTGG - Intergenic
1093331748 12:17851906-17851928 CAACTACCCTTCTCAGCCTGTGG + Intergenic
1093724259 12:22485296-22485318 CCACTACCCTTCCCAGCCTCTGG - Intronic
1093887672 12:24481248-24481270 CCACTACGCTTTCCAGCCTCTGG - Intergenic
1093984512 12:25514496-25514518 CCACTACCCTTCCCAGCCTCTGG - Intronic
1093992084 12:25601290-25601312 CCACTACCCTTCCCAGCCTCTGG - Intronic
1094441028 12:30477278-30477300 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1094442479 12:30493915-30493937 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1095163800 12:38948053-38948075 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1095361090 12:41340419-41340441 TCACTACCCTTCCCAGCCTCTGG - Intronic
1095680317 12:44967219-44967241 CCACTACCCTTTTCAGCCTCTGG - Intergenic
1095870024 12:47016803-47016825 TCACTACACTTCCCAGCCTCTGG - Intergenic
1096291705 12:50349179-50349201 CCACTACCCTTTCTAGCCTATGG + Intronic
1096449946 12:51730861-51730883 CCACTACCCTTCCCAGCCTTTGG + Intronic
1097364618 12:58698067-58698089 CCACTACCCTTCCCAGCCTCTGG + Intronic
1097714188 12:62948138-62948160 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1097756483 12:63412570-63412592 CCACTACCCTTTTCAGGCTCTGG + Intergenic
1097770441 12:63578300-63578322 TCACTATCCTTCCCAGCCTCTGG - Intronic
1097870682 12:64599594-64599616 TCACTACACTACACAGCCTTCGG - Intergenic
1098249607 12:68555748-68555770 TCACTACCCTTCCCAGACTCTGG - Intergenic
1098320056 12:69234033-69234055 TCATTACCCTTCCCAGCCTCTGG - Intergenic
1099025006 12:77454736-77454758 TCATTACCCTTCCCAGCCTCTGG - Intergenic
1099055280 12:77832783-77832805 CCACTACCCTTTCCAGCCTCTGG + Intronic
1099724747 12:86411867-86411889 TCACTACTCTGTACAACCTTGGG + Intronic
1099736624 12:86575363-86575385 CCAATACCCTTCACAGCCTCTGG + Intronic
1099890880 12:88586850-88586872 TCACTGCCCTGTGCAGCCTTAGG - Intergenic
1100060484 12:90569168-90569190 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1100356159 12:93832166-93832188 TCACTGCCCCTTACAGCTTTGGG + Intronic
1100449468 12:94691547-94691569 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1100480627 12:94974837-94974859 CCACTACCCTTCCCAGCCTCTGG - Intronic
1100946869 12:99794684-99794706 CCACTACCCTTCCCAGCCTCTGG - Intronic
1100974544 12:100108901-100108923 CCACTACCCTTTCCAGCCTCTGG - Intronic
1101143171 12:101817030-101817052 CCACTACCCTTTCCATCCTCTGG - Intronic
1101499772 12:105292188-105292210 TCCCTACCCTCTGCAGCCTCTGG - Intronic
1101703672 12:107199466-107199488 TCACTACCCTTCCCAGCTTCTGG + Intergenic
1102405885 12:112673837-112673859 CCACTACCCTTCCCAGCCTCTGG + Intronic
1102648844 12:114422206-114422228 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1102812411 12:115835779-115835801 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1103169758 12:118806637-118806659 CCACTACCCTTCCCAGCCTGTGG + Intergenic
1104136201 12:125941314-125941336 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1104204745 12:126627751-126627773 TCCCTACCCTCCTCAGCCTGTGG - Intergenic
1105459939 13:20575109-20575131 CCACTACCCTTCCCAGCCTCTGG + Intronic
1105587491 13:21758533-21758555 TCACTACCAAGTACATCCTGTGG - Intergenic
1105726455 13:23167049-23167071 TCACTACCCTTCCCAGCCTTTGG + Intergenic
1106388347 13:29310069-29310091 CCACTACCCTTCCCAGCCTCTGG + Intronic
1106860429 13:33901523-33901545 TCTCTACCCTTCCCAGCCTCTGG - Intronic
1107105385 13:36637161-36637183 TCACTACCCTGTGCAGCCTCAGG - Intergenic
1107400899 13:40068204-40068226 TCAGAACCCCTTACACCCTGAGG + Intergenic
1108138495 13:47392304-47392326 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1108229775 13:48324373-48324395 CCACTACCCTTCACAGCTTCTGG + Intronic
1108664395 13:52615517-52615539 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1109147080 13:58792185-58792207 CCATTACCCTTTCCAGCCTCTGG + Intergenic
1109336145 13:60997180-60997202 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1109725394 13:66334194-66334216 CCACTACCCTTCCCAGCCTCTGG + Intronic
1110128235 13:71975225-71975247 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1110330569 13:74267567-74267589 CCCCTACACTTTCCAGCCTGTGG - Intergenic
1110378122 13:74817064-74817086 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1110568549 13:76980136-76980158 TCTCTTCCCTCTGCAGCCTGCGG - Intergenic
1110890164 13:80688934-80688956 CCACTGCCCTGTACAGCCTCAGG - Intergenic
1110947428 13:81440427-81440449 CCACTACCCTTGCCAGCCTCTGG - Intergenic
1111442564 13:88299387-88299409 TCACTACCCTTCCTAGCCTCTGG + Intergenic
1111512859 13:89288144-89288166 CCACTTCCCTTTCCAGCCTTTGG + Intergenic
1111583104 13:90250033-90250055 TCAGTACCCTTTAGAGCCTCTGG + Intergenic
1111757771 13:92420641-92420663 TTACTACCCTTCCCAGCCTCTGG + Intronic
1111838291 13:93416700-93416722 CCACTACCCTTCCCAGCCTCTGG + Intronic
1112531923 13:100212885-100212907 CCACTACCCTTCCCAGCCTCTGG + Intronic
1112606977 13:100916032-100916054 TCACTACCCTTCCCAGTCTCTGG - Intergenic
1112904284 13:104398005-104398027 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1113130563 13:107032007-107032029 TTCCTACCCTTTACAGTTTGGGG - Intergenic
1114274323 14:21128613-21128635 TGACTACCCTTCTCAGCCTCTGG - Intergenic
1114369017 14:22064886-22064908 TCACTACTCTTCCCAGCCTCTGG - Intergenic
1114443407 14:22769203-22769225 TGACTACCCTTCCCAGCCTCTGG + Intronic
1114878032 14:26747663-26747685 CAACTACCCTTCACAGCCTCTGG - Intergenic
1114898493 14:27025775-27025797 TCACTACCCTTTCCAGACTTTGG + Intergenic
1115200151 14:30844300-30844322 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1115381039 14:32739518-32739540 CTACTACCCTTTCCAGCCTCTGG + Intronic
1115431639 14:33325785-33325807 TCACTACACTTTCCAGCCTCTGG + Intronic
1115539052 14:34401785-34401807 TGACTACCCTTCCCAGCCTCTGG - Intronic
1116034190 14:39608272-39608294 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1116256131 14:42558842-42558864 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1116269686 14:42745583-42745605 TCACTAGCCTTCCCAGCCTCTGG - Intergenic
1116445140 14:45000350-45000372 TCACTGCCCTTGCCAGCCTCTGG + Intronic
1116489398 14:45488365-45488387 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1116491977 14:45515443-45515465 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1116506114 14:45683764-45683786 CCATTACCCTTCACAGCCTCTGG + Intergenic
1117378429 14:55136813-55136835 TCACTACCTTTCCCAGCCTCTGG + Intronic
1117666494 14:58061610-58061632 TCACTAGCCTTTACATTCAGTGG - Intronic
1117667400 14:58070863-58070885 CCACTACCCTTCCCAGCCTCTGG + Intronic
1117711863 14:58538725-58538747 TCACTACCATTCCCAGCCTGTGG + Intronic
1117765407 14:59076788-59076810 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1117780883 14:59230583-59230605 CCACTACCCTTCCCAGCCTCTGG - Intronic
1117934118 14:60882244-60882266 TCACTACCCTTCACAACCTCTGG + Intronic
1118097376 14:62552616-62552638 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1118114281 14:62757790-62757812 CCACTACCCATTCCAGCCTCTGG - Intronic
1118430365 14:65713054-65713076 CCACTACCTTTTCCAGCCTCTGG + Intronic
1118659066 14:67987339-67987361 CCACTACCCTTCCCAGCCTCTGG + Intronic
1119627134 14:76187866-76187888 TCATTACCCTTCCCAGCCTCTGG + Intronic
1120086856 14:80285442-80285464 TCACTATCCTTCCCAGCCTCAGG - Intronic
1120426750 14:84358134-84358156 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1120587899 14:86338003-86338025 TCACTACCCTTTCCAGCCTCTGG + Intergenic
1120627554 14:86847617-86847639 CCACTACCCTTACCAGCCTCTGG - Intergenic
1120736620 14:88060186-88060208 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1120940939 14:89948823-89948845 TCACTATCCTTCCCAGCCTCTGG - Intronic
1121131022 14:91447566-91447588 TTACTACCCTTCCCAGCCTCTGG - Intergenic
1121153320 14:91658375-91658397 CCACTACCCTTCCCAGCCTCTGG - Intronic
1121944023 14:98101901-98101923 CCACTACCCTTCCCAGCCTTTGG - Intergenic
1122956709 14:105074648-105074670 TCATTGCCCTTCACAGCGTGGGG + Intergenic
1124073226 15:26415058-26415080 TCACTATCCTTTCCAGCCTCTGG - Intergenic
1124087379 15:26563491-26563513 TGGCTCCCCTTTACAGGCTGTGG - Intronic
1124145529 15:27121949-27121971 CCACTACCCTTCCCAGCCTCTGG - Intronic
1125059665 15:35403874-35403896 CCACTACCATTTCCAGCCTCTGG + Intronic
1125063485 15:35453388-35453410 TGGCTACCCATTAAAGCCTGTGG + Intronic
1125134076 15:36321158-36321180 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1125877147 15:43159391-43159413 TTACTACCCTTTCTAGCCTCTGG + Intronic
1126610587 15:50525251-50525273 TCACTCCCCTCCCCAGCCTGTGG - Intronic
1126708862 15:51434308-51434330 CCAATACCCTTTCCAGCCTCTGG + Intergenic
1126846847 15:52768024-52768046 CCACTACCCTTCCCAGCCTCTGG - Intronic
1126975355 15:54172098-54172120 CCACTACCCTTCCCAGCCTCTGG - Intronic
1127219453 15:56862623-56862645 TCACTACCCTTCCCACCCTCTGG - Intronic
1127459362 15:59183832-59183854 CCACTACCCTTCCCAGCCTCTGG + Intronic
1127840789 15:62829788-62829810 TCACTACCCTTCCCAGCCTCTGG + Intronic
1128402627 15:67299260-67299282 GCACTACCCTTCCCAGCCTCTGG - Intronic
1128436201 15:67651530-67651552 TCACTACCCTTCTCAGTCTCTGG + Intronic
1129135777 15:73549356-73549378 CCACTACCCTTCCCAGCCTCTGG - Intronic
1129545943 15:76395000-76395022 CCACTACCCTTCCCAGCCTGTGG + Intronic
1129562322 15:76584260-76584282 CCACTACCCTTACCAGCCTCTGG - Intronic
1129907531 15:79199215-79199237 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1130131884 15:81150488-81150510 CTAGTACCCTTTCCAGCCTGTGG + Intergenic
1130299899 15:82672451-82672473 CCACTACCCTTCTCAGCCTCTGG - Intronic
1130606349 15:85320660-85320682 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1130819769 15:87482402-87482424 TCACTACCCTTTCCAGGCACTGG - Intergenic
1131237175 15:90706698-90706720 CCACTTCTATTTACAGCCTGGGG - Intergenic
1131722699 15:95188066-95188088 CCACTGCCCTTCACAGCCTTTGG + Intergenic
1131947490 15:97642300-97642322 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1131976764 15:97954558-97954580 TCCCTACCGTTTACTGGCTGTGG + Intergenic
1132444451 15:101899801-101899823 CCACTACCCTTCACAGCCTCTGG + Intergenic
1133076632 16:3285218-3285240 CCCCTCTCCTTTACAGCCTGGGG - Exonic
1133541351 16:6757633-6757655 TCTCTACCCTTCCCAGCCTCTGG - Intronic
1133699245 16:8293835-8293857 TCACTACCCTTCCCAGCTTCTGG - Intergenic
1133751103 16:8726080-8726102 CCACTACCCTTCCCAGCCTCTGG + Intronic
1133920546 16:10149060-10149082 CCAATACCCTTTCCAGCCTCTGG - Intronic
1134225119 16:12383869-12383891 CCACTACCCTTCTCAGCCTCTGG + Intronic
1134563732 16:15232833-15232855 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1134881665 16:17750092-17750114 CCACTACCCTTCCCAGCCTGTGG - Intergenic
1135604764 16:23813911-23813933 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1135604781 16:23813951-23813973 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1135615995 16:23911687-23911709 CCACTCACCTTTCCAGCCTGTGG + Intronic
1135977291 16:27117053-27117075 CCACTACCCTTCGCAGCCTCTGG + Intergenic
1137226790 16:46520470-46520492 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1137851185 16:51745453-51745475 TGACTACCCTTCCCAGCCTCTGG - Intergenic
1137963078 16:52904840-52904862 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1138469158 16:57218488-57218510 CCACTACCCTTCCCAGCCTCTGG + Intronic
1138764686 16:59587811-59587833 TTACTACCCTTCCCAGCCTCTGG + Intergenic
1139085734 16:63583488-63583510 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1139325015 16:66145885-66145907 CCACTATCCTTTACAACCTTGGG - Intergenic
1139413735 16:66788975-66788997 CCACTACCCTTCCCAGCCTCTGG - Intronic
1140142128 16:72268185-72268207 CCACTACCCTTCATAGCCTCTGG + Intergenic
1140264659 16:73409958-73409980 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1142074843 16:88111528-88111550 CCACTTCCCTTCCCAGCCTGTGG + Intronic
1143143149 17:4754490-4754512 ACACTACCCTTCCCAGCCTCTGG + Intergenic
1143167826 17:4907036-4907058 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1143854298 17:9837267-9837289 CCACTACCCTTCCCAGCCTCTGG + Intronic
1144322876 17:14147490-14147512 CCACTACCCTTCCCAGCCTCTGG - Intronic
1147025101 17:37575141-37575163 CCACTACCCTTCTCAGCCTCTGG - Intronic
1147487420 17:40830463-40830485 ACACTACCCTTCCCAGCCTCTGG - Intronic
1148243476 17:46014950-46014972 TCACTACCCTTCCCAGCCTCTGG - Intronic
1149376924 17:56053298-56053320 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1149411875 17:56417049-56417071 CCACTACCCTTCCCAGCCTCTGG - Intronic
1150871434 17:68916112-68916134 CCACTACCCTTCTCAGCCTCTGG - Intronic
1150945797 17:69744149-69744171 ACACTACCCTTCCCAGCCTCTGG - Intergenic
1151053656 17:71007374-71007396 TCACAACCCTTCCCAGCCTCTGG - Intergenic
1151128871 17:71875216-71875238 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1152032065 17:77849213-77849235 TCCCTACCCTTCCCAGCCTCTGG + Intergenic
1152077347 17:78168067-78168089 ACACTGCCCTTCACAGCCTTGGG + Intergenic
1152548033 17:81012743-81012765 CCACTTCCCTATACAGCCTCAGG + Intergenic
1153183032 18:2457302-2457324 CCTCTACCCTTCCCAGCCTGTGG + Intergenic
1153388269 18:4525081-4525103 TCACTACCCTTTCCAGCCTATGG + Intergenic
1153445869 18:5172183-5172205 CCACTACCCTTCCCAGCCTCTGG - Intronic
1153511618 18:5860805-5860827 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1153556727 18:6322731-6322753 CCACTACCCTTCCCAGCCTTTGG - Intronic
1153603103 18:6801914-6801936 CCTCTACCCTTTTCAGCCTCTGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155255273 18:23991781-23991803 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1155309215 18:24507917-24507939 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1155317195 18:24583823-24583845 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1155411351 18:25548752-25548774 CCATTACCCTTTCCAGCCTGTGG - Intergenic
1155968547 18:32058775-32058797 CCACTACCCTTCCCAGCCTCTGG + Intronic
1156277600 18:35598387-35598409 TCCCTACCCTTCCCAGCCTCTGG + Intronic
1156325155 18:36067908-36067930 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1156615866 18:38783523-38783545 TCACTGCCCTGAACAGCCTCGGG - Intergenic
1156937149 18:42723854-42723876 TCACTACCCTTCCTAGCCTCTGG - Intergenic
1156967388 18:43111287-43111309 CTACTACCCTTTCCAGCCTCTGG - Intronic
1157915910 18:51663719-51663741 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1158145034 18:54302771-54302793 CCACTACCCTTCCCAGCCTCTGG + Intronic
1158843694 18:61417642-61417664 ACACTACCCTTCCCAGCCTCTGG - Intronic
1158881856 18:61787240-61787262 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1159081034 18:63736385-63736407 CCACTACCCTTCCCAGCCTTTGG - Intergenic
1159091443 18:63853659-63853681 TCACTAACCTTCCCAGCCTCTGG + Intergenic
1159202860 18:65209758-65209780 CCACTACCCTTCACAGCCTCTGG + Intergenic
1159339157 18:67112296-67112318 TCACTACCATTTCCAGCCTCTGG + Intergenic
1159423794 18:68257793-68257815 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1159572303 18:70130622-70130644 CCACCATCCTTTACAGCCTGTGG - Intronic
1159774841 18:72591645-72591667 CCACTACCCTTCCCAGCCTTTGG + Intronic
1159860609 18:73644319-73644341 TGACAACCCTTTCCAGCCTCTGG - Intergenic
1159930508 18:74308194-74308216 TTATTACCCTTTCCAGCCTCTGG - Intergenic
1160051388 18:75437430-75437452 CCATTACCCTTTCCAGCCTCTGG - Intergenic
1160120620 18:76127537-76127559 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1160640903 19:135014-135036 CCACTACCCTTCACAGCCTCTGG - Intergenic
1161841822 19:6686317-6686339 TCACTGCTCTGTCCAGCCTGGGG + Intronic
1161873943 19:6892986-6893008 CCACTATCCTTTCCAGCCTCTGG + Intronic
1162698290 19:12494609-12494631 GCACTACCCTTTCCAGCCTCTGG - Intronic
1163224921 19:15952855-15952877 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1164398414 19:27886353-27886375 CCACTACCCCTTCCAGCCTCTGG + Intergenic
1166009563 19:39932270-39932292 CCGCTACACTTTCCAGCCTGTGG - Intronic
1166180767 19:41106872-41106894 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1166867051 19:45845352-45845374 CCATTACCCTTTTCAGCCTCTGG + Intronic
1167418884 19:49391115-49391137 TCACTACCCCTTATCTCCTGTGG + Intronic
1168465849 19:56600548-56600570 CCACTACCCTTCCCAGCCTCAGG + Intronic
1168629645 19:57947088-57947110 TCATAACCCTTTACAGCCAAGGG + Intronic
925021438 2:572618-572640 CCACTACCCTTCCCAGCCTCTGG - Intergenic
925490365 2:4385636-4385658 CCACTACCCTTCCCAGCCTCAGG + Intergenic
926086435 2:10023137-10023159 GCACTGGCCTTTACACCCTGAGG - Intergenic
926100706 2:10115265-10115287 TCACTATCCATTAAAACCTGTGG + Intergenic
926497808 2:13613563-13613585 CCACTACTCTTTTCAGCCTCTGG + Intergenic
926588035 2:14710514-14710536 TCCCTACACTTTCCAGCCTCTGG - Intergenic
926867772 2:17378397-17378419 CCACTACCCTTCCCAGCCTCTGG + Intergenic
926984374 2:18605945-18605967 TCACTTGCCTTAAGAGCCTGCGG - Intergenic
927196364 2:20550330-20550352 TCACTCACCTTTATAGGCTGAGG + Intergenic
928001902 2:27530748-27530770 CCACTACCCTTCTCAGCCTCTGG - Intergenic
928474032 2:31606139-31606161 CCACTACCCTTCCCAGCCTCTGG - Intergenic
928486146 2:31734324-31734346 ACACTACCCTTCTCAGCCTCTGG - Intergenic
928609043 2:32973743-32973765 TCACTACCCTTCTCAGCCTCTGG + Intronic
928707353 2:33964591-33964613 CCACTACCCTTCCCAGCCTCTGG + Intergenic
928932978 2:36644692-36644714 TCACTACCCTTCCCAGACTTTGG - Intronic
928996717 2:37300362-37300384 CCACTACCCTTCAGAGCCTCTGG - Intronic
929318085 2:40505187-40505209 TAACTACCCTTGCCAGCCTCTGG - Intronic
929973287 2:46604699-46604721 CTACTACCCTTCCCAGCCTGTGG - Intronic
930363842 2:50414021-50414043 CCACTACCCTTCCCAGCCTCTGG - Intronic
930442514 2:51426905-51426927 CCACTACCCTTCCCAGCCTTTGG - Intergenic
930527875 2:52553483-52553505 TCACTACCCTTCCTAGCCTCTGG - Intergenic
930752390 2:54945930-54945952 TCACAACCCTGTACCCCCTGTGG - Intronic
930953851 2:57179119-57179141 CCACTACCCTTCCCAGCCTCTGG + Intergenic
930968620 2:57365330-57365352 TCACTATCCTTTCCAGCCTCTGG - Intergenic
930970501 2:57389420-57389442 CCACTACCCTTCCCAGCCTCTGG - Intergenic
931001423 2:57788361-57788383 CCACTACCCTTCACAGCCTCTGG + Intergenic
931484622 2:62677640-62677662 CCACTACCCGTTGCAGCCTCTGG + Intronic
931529798 2:63200662-63200684 CCACTACCCTTTCCAGCCTCTGG - Intronic
931927669 2:67091948-67091970 CCACTACCCTTCCCAGCCTCTGG - Intergenic
932101581 2:68905829-68905851 CCACTACCCTTCCCAGCCTCTGG - Intergenic
932187143 2:69707878-69707900 CCACTACCCTTCCCAGCCTCTGG + Intronic
932287137 2:70544860-70544882 CCACTACCCTTTCTAGCCTCTGG - Intronic
932645648 2:73498565-73498587 TCACTACCTTTCTCAGCCTCTGG + Intronic
932648010 2:73524886-73524908 TCACTACCCTTCCCAGTCTCTGG + Intronic
932858464 2:75263798-75263820 CTACTACCCTTTTCAGCCTCTGG + Intergenic
933098344 2:78217133-78217155 CCACTACCCTTCCCAGCCTCTGG - Intergenic
933326078 2:80839128-80839150 TCACTACCCTTCCCAGTCTCTGG + Intergenic
933339128 2:80999143-80999165 CCACTACCCATCCCAGCCTGTGG + Intergenic
933348634 2:81124430-81124452 CCACTACCCTTCCCAGCCTCTGG + Intergenic
933627425 2:84617548-84617570 CCACTACCCTTCCCAGCCTCTGG + Intronic
934551417 2:95265069-95265091 TCCCTGCCCTTTGCAGGCTGAGG + Intergenic
935358207 2:102224554-102224576 CCACTACCCTTCCCAGCCTCTGG - Intronic
935417141 2:102830856-102830878 CCACTACCCTTCCCAGCCTCTGG + Intronic
935749479 2:106218432-106218454 CCACTACCCTTCCCAGCCTCTGG - Intergenic
935978100 2:108599188-108599210 CCACTACCCTTCACAGCCTCTGG + Intronic
936121816 2:109752874-109752896 CCACTTCCCTTTCCAGCCTCTGG + Intergenic
936222879 2:110618598-110618620 CCACTTCCCTTTCCAGCCTCTGG - Intergenic
936510802 2:113144260-113144282 TCACTACCTTTTGCAGCCTCTGG + Intergenic
936793616 2:116181785-116181807 TCACTACCCTTCCTAGCCTCTGG + Intergenic
936872419 2:117148454-117148476 GCACTACCCTTTCCGGCCTCTGG + Intergenic
937504344 2:122519831-122519853 TCACTATCTTTTCCAGCCTCTGG - Intergenic
938194197 2:129312202-129312224 CCACTACTCTTTGCATCCTGAGG - Intergenic
938217252 2:129529215-129529237 TGACTACCCTTCCCAGCCTCTGG - Intergenic
938485033 2:131696462-131696484 TCACTACCCTTCCCAGCCTCTGG + Intergenic
939062882 2:137445598-137445620 CTACTACCCTTTCCAGCCTCTGG - Intronic
939242327 2:139576923-139576945 ATACTACCCTTCACAGCCTCTGG + Intergenic
939649556 2:144744387-144744409 TCACTACCCTTCCCAGCCTCTGG + Intergenic
939707409 2:145471981-145472003 TCACTACCCTACCCAGCCTCTGG + Intergenic
939948802 2:148443735-148443757 CCACTACCCTTCCCAGCCTCTGG - Intronic
940070826 2:149685794-149685816 TCACTACCCTTCCTAGCCTCTGG - Intergenic
940399992 2:153237475-153237497 CCACTACCCTTCTCAGCCTCTGG + Intergenic
940443435 2:153747359-153747381 TCACTACCCTTCCCAGCCTCTGG + Intergenic
940710711 2:157160306-157160328 TCACTGCCCGTTACTGCCTAAGG + Intergenic
940729825 2:157375802-157375824 TCATTGCCCTTTGCAGCCTAGGG - Intergenic
940923711 2:159339907-159339929 TCCCTACCCTTCTCAGCCTCTGG - Intronic
940929786 2:159414256-159414278 TCACTATCCTTCCCAGCCTCTGG - Intronic
941341312 2:164308639-164308661 CCACTACCCTTCCCAGCCTCTGG - Intergenic
941851277 2:170184338-170184360 CCACTACCCTTCCCAGCCTCTGG + Intronic
942395625 2:175545482-175545504 CCACTACCCTTCCCAGCCTCTGG - Intergenic
942813798 2:180027661-180027683 TCCCTACCCTTCCCAGCCTCTGG + Intergenic
942863480 2:180644379-180644401 CCACTACCCTCTGCAGCCTCTGG - Intergenic
943148397 2:184076380-184076402 TCACTACCCTTCCCAGCCTCTGG - Intergenic
943168761 2:184368724-184368746 TCACTACTCTTCCCAGCCTCTGG - Intergenic
943347662 2:186758953-186758975 ACACTACCCTTCCCAGCCTCTGG + Intronic
943430063 2:187788621-187788643 TGACTACCCTTCCCAGCCTTTGG - Intergenic
943582429 2:189700681-189700703 CCACTACCCTTCCCAGCCTCTGG + Intronic
944095503 2:195962764-195962786 TCACTACCCTTCCCAGCTTTTGG + Intronic
944133024 2:196367640-196367662 CCACTACCCTTCCCAGCCTCTGG + Intronic
945161193 2:206892845-206892867 CCACTACCCTTCCCAGCCTCTGG + Intergenic
945211236 2:207384873-207384895 CCCCTACCCTTCCCAGCCTGTGG - Intergenic
945336920 2:208603450-208603472 CCACTACCCTTCCCAGCCTCTGG - Intronic
945902143 2:215550739-215550761 CCACTATCCTTTCCAGCCTCTGG - Intergenic
946088863 2:217202282-217202304 TCACTACCCTTCCCAGCCTCTGG - Intergenic
946453947 2:219806105-219806127 CCACTACCCTTCTCAGCCTCTGG + Intergenic
946496868 2:220203826-220203848 TTACTGTCCTTTACAGACTGGGG + Intergenic
946512893 2:220379053-220379075 TCTCTACCCTTTTCAGCCTCTGG + Intergenic
946676761 2:222168596-222168618 TCACTACCCTTCCCAGGCTCTGG + Intergenic
946694421 2:222339607-222339629 CCACTACCCTTCCCAGCCTCTGG - Intergenic
946796843 2:223363463-223363485 CAACTACCCTTTCCAGCCTCTGG - Intergenic
946995271 2:225384088-225384110 TCACTGCCCTCTGCAGCCTGGGG + Intergenic
947342913 2:229158919-229158941 CCCCTACCCTTCACAGCCTCTGG - Intronic
947870365 2:233433436-233433458 CCACTACCCTTCCCAGCCTCTGG - Intronic
1168772753 20:426350-426372 TCACTACCCTTTGCAGCCTCTGG + Intronic
1169852625 20:10069121-10069143 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1169996804 20:11566682-11566704 TCACTACCCTTCCCAACCTCTGG + Intergenic
1170086747 20:12542539-12542561 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1170608557 20:17893211-17893233 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1170725303 20:18920762-18920784 TATCTTCCCTGTACAGCCTGTGG + Intergenic
1170818076 20:19731916-19731938 ACACTACCCTTCCCAGCCTCTGG + Intergenic
1171024929 20:21621598-21621620 TCACTACTCTTCCCAGCCTCTGG - Intergenic
1171776909 20:29377195-29377217 TCACTGCCCTTCCCAGCCTCTGG + Intergenic
1172203271 20:33141967-33141989 TCACTACCCTTTCCAGCCTCTGG + Intergenic
1173406846 20:42773765-42773787 TCACTCCCCCTTTAAGCCTGTGG - Intronic
1173557896 20:43980363-43980385 CCACTACCCTTCCCAGCCTCTGG - Intronic
1174288821 20:49492318-49492340 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1175077635 20:56389535-56389557 TCAGTACCATCTACAGGCTGAGG + Intronic
1175141248 20:56861706-56861728 GCACTCCACTTTACAGCCAGAGG - Intergenic
1175730721 20:61352147-61352169 TCACTACCCTTCCCAGCCTCTGG + Intronic
1175732016 20:61360611-61360633 TCACCACCCAGTCCAGCCTGGGG + Intronic
1176102221 20:63369765-63369787 GCACTGCCTTTTTCAGCCTGTGG + Intronic
1177231244 21:18322711-18322733 CCACTACCCTTCTCAGCCTCTGG - Intronic
1177459318 21:21389589-21389611 TCAATATCCTTTCCAGCCTCTGG + Intronic
1177567059 21:22837638-22837660 CCACTACCCTTACCAGCCTCTGG - Intergenic
1177569431 21:22868937-22868959 TCCCTACCCTTCCCAGCCTCTGG + Intergenic
1177584858 21:23077997-23078019 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1177865213 21:26504807-26504829 TGACTACCCTTCCCAGCCTCTGG + Intronic
1177873551 21:26602869-26602891 TGACTACCCTTCCCAGCCTATGG + Intergenic
1178017570 21:28367517-28367539 TCACTACCCTTCCCAGCCACTGG + Intergenic
1178177739 21:30123744-30123766 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1179653123 21:42827580-42827602 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1180847377 22:18991250-18991272 GCACTACCCATGACAGCCTCGGG - Intergenic
1182164537 22:28160048-28160070 CCACTACCCTTCCCAGCCTCTGG - Intronic
1182326409 22:29516640-29516662 GCCCTGCCCTTTACAACCTGAGG + Intronic
1182627429 22:31657870-31657892 CCACTACCCTTTCCAGCTTCTGG + Intronic
1182683914 22:32105733-32105755 CCACTACCCTTCCCAGCCTCTGG + Intronic
1182908661 22:33960732-33960754 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1183999456 22:41662061-41662083 TCACTACCCTTCTCAGCCTCTGG - Intronic
1184703334 22:46192963-46192985 TCACCACCCTTCCCAGCCTCTGG - Intronic
1184733044 22:46381506-46381528 GCACTACCCATGACAGCCTTGGG + Intronic
1184862974 22:47186743-47186765 CCACTACCATTTCCAGCCTCTGG - Intergenic
949720586 3:6985357-6985379 CCACTACCCTTCCCAGCCTCTGG + Intronic
950266142 3:11574476-11574498 TCCCTACCCTTCCCAGCCTCTGG - Intronic
950694966 3:14691898-14691920 ACACTACCCTTCCCAGCCTCTGG + Intronic
950960836 3:17105171-17105193 TCACTACCCTTCCCAGCCTCTGG - Intergenic
951177344 3:19617333-19617355 CCACTACCTTTCCCAGCCTGTGG + Intergenic
951434500 3:22645901-22645923 CCACTACCCTTCCCAGCCTCTGG + Intergenic
951760573 3:26143232-26143254 CCACTACCCTTCCCAGCCTCTGG - Intergenic
951828527 3:26897307-26897329 CCACTACCCTTCCCAGCCTCTGG + Intergenic
952102586 3:30032061-30032083 TCCCTTCCCTTTCCAGCCTCTGG + Intergenic
952109476 3:30106060-30106082 CCACTACCCTTCCCAGCCTTTGG + Intergenic
952532654 3:34278159-34278181 TCACTACCCTTCCCAGCCCCTGG - Intergenic
952566483 3:34665441-34665463 TCTCTACCCTTCTCAGGCTGTGG + Intergenic
953164001 3:40447979-40448001 TCACTACCCTTCCCAGCCTCTGG - Intergenic
953231340 3:41067506-41067528 CCATTACCCTTCTCAGCCTGTGG - Intergenic
953353895 3:42237969-42237991 CCACTACCCTTCCCAGCCTCTGG - Intergenic
953587461 3:44216873-44216895 TCACTATTCTTCACAGCCTCTGG - Intergenic
953976935 3:47389047-47389069 CCACTACCCTTCCCAGCCTCTGG + Intronic
954263169 3:49454673-49454695 GCACTGCCCTCTAGAGCCTGAGG - Intergenic
954281724 3:49584786-49584808 CCACTACCCTTCCCAGCCTCTGG + Intronic
954471526 3:50700432-50700454 TCCCTACCTTTTCCAGCCTTTGG + Intronic
954817119 3:53291479-53291501 CCACTACCCTTCCCAGCCTCTGG + Intronic
955165888 3:56510815-56510837 TCACTACCCTTCCCAGCATCTGG - Intergenic
955249390 3:57263407-57263429 ACACTACCCTTCTCAGCCTCTGG + Intronic
955273567 3:57526117-57526139 CCACTACCATTCACAGCCTCTGG + Intronic
955481066 3:59390977-59390999 CCACTACCCTTCCCAGCCTCTGG + Intergenic
956567089 3:70651172-70651194 TCACTACCGTTCCCAGCCTCTGG - Intergenic
956852218 3:73239795-73239817 CCACTACCCTTCCCAGCCTCTGG + Intergenic
956990505 3:74757441-74757463 CCACTACCCTTCCCAGCCTCTGG + Intergenic
957088175 3:75702461-75702483 TCACTGCCCTTCCCAGCCTCTGG - Intergenic
957280499 3:78145172-78145194 CCACTACCCTTTCTAGCCTCTGG + Intergenic
957369907 3:79280081-79280103 TGCCTACCCTTCCCAGCCTGTGG - Intronic
957731809 3:84148549-84148571 CCACTACCCTTCCAAGCCTGTGG + Intergenic
957818225 3:85331281-85331303 CCACTACCCTTCCCAGCCTCTGG + Intronic
957888708 3:86326565-86326587 TCACTACCCTCCTCAGCCTCTGG - Intergenic
957889719 3:86340726-86340748 CCACTACCCTTCCCAGCCTGTGG + Intergenic
958023478 3:88024036-88024058 CCACTTACCTTTACAGCCTCTGG - Intergenic
958631747 3:96693195-96693217 ACACTACCCTTCTCAGCCTCTGG + Intergenic
958710195 3:97708737-97708759 CCACTGCTCTGTACAGCCTGAGG + Intronic
958838820 3:99178407-99178429 CCACTACCCTTCCCAGCCTCTGG - Intergenic
958968870 3:100589192-100589214 TCATTACCCTTCCCAGCCTCTGG + Intergenic
958976198 3:100670159-100670181 TCACTACCATTCCCAGCCTCTGG + Intronic
959443616 3:106410211-106410233 CCACTACCCTTTCCAGCATCTGG + Intergenic
959612244 3:108308162-108308184 CCACTACCCTTCCCAGCCTCTGG + Intronic
959717976 3:109454415-109454437 CCACTACCCTTCTCAGCCTCTGG - Intergenic
959779680 3:110214524-110214546 CCACTACCCTTCCCAGCCTCTGG - Intergenic
959801769 3:110503605-110503627 TCACTACCAGTCACAGCCTCTGG - Intergenic
960014039 3:112865680-112865702 ACACTACCCTTGCCAGCCTGTGG + Intergenic
960079864 3:113530034-113530056 CCACTACCCTTCCCAGCCTCTGG - Intergenic
960123131 3:113967794-113967816 CCTCTACCCTTTCCAGCCTCTGG + Intronic
960235519 3:115277584-115277606 CCACTACCCTTCCCAGCCTCTGG + Intergenic
960471251 3:118068353-118068375 CCACTACCCTTCCCAGCCTCTGG + Intergenic
960542520 3:118877333-118877355 TCACTACCTTTCCCAGCCTCTGG + Intergenic
960563014 3:119106361-119106383 CCACTACCCTTCCCAGCCTCTGG + Intronic
961055635 3:123786493-123786515 CCACTACCCTTCCCAGCCTCTGG - Intronic
962015642 3:131437626-131437648 CCACTACCCTTTCCAGCCTCTGG - Intergenic
962077430 3:132097650-132097672 TCACTACCCTTCCCAGCCTCTGG - Intronic
962139684 3:132776095-132776117 CCACTACCCTTCCCAGCCTCTGG - Intergenic
962401257 3:135060944-135060966 TCACTACCCCTCCCAGCCTCTGG + Intronic
962484467 3:135828988-135829010 TCACTACCCATTCCAGCCTCTGG - Intergenic
962758116 3:138483748-138483770 CCACTATCCTTTCCAGCCTCTGG + Intergenic
962816771 3:139007259-139007281 TCACTACCCTTCCCAGCTTCTGG + Intronic
963201052 3:142586084-142586106 CCACTACCCTTCCCAGCCTCTGG + Intergenic
963411822 3:144937993-144938015 CCACTACCCTTCCCAGCCTCTGG - Intergenic
963582474 3:147143357-147143379 CCACTACTCTTTCCAGCCTCTGG - Intergenic
963716307 3:148808195-148808217 ACACTATCCTTAACCGCCTGTGG - Intronic
964378882 3:156076126-156076148 TCACTACCCTTACCAGCCTCTGG + Intronic
964810327 3:160656493-160656515 CTACTACCCTTCACAGCCTCTGG - Intergenic
964865875 3:161260134-161260156 CCACTACCCTTCCCAGCCTTTGG + Intergenic
964902853 3:161680932-161680954 TAACTACCCTTTACAACAGGGGG + Intergenic
965048008 3:163604122-163604144 CCACTTCCCTTTCCAGCCTCTGG - Intergenic
965174505 3:165314468-165314490 CCACTACACTTTGCAGCCTCTGG + Intergenic
965321444 3:167256621-167256643 CCACTACCCTTTCAAGCCTCTGG + Intronic
965833678 3:172827613-172827635 CCACTACCCTTCCCAGCCTCTGG - Intergenic
966069525 3:175858455-175858477 CCACTACCCTTACCAGCCTCTGG - Intergenic
966094270 3:176179808-176179830 CCACTACCGTTTCCAGCCTCTGG - Intergenic
966338007 3:178892479-178892501 CCACTACCCTTCACAGCCTCTGG - Intergenic
966338070 3:178893258-178893280 CCACTACCCTTCACGGCCTCTGG - Intergenic
966349043 3:179011214-179011236 TCACTACCCTTCCCAGCCTCTGG - Intergenic
966491632 3:180533765-180533787 CCAATACCCTTTCCAGCCTCTGG - Intergenic
966730709 3:183149183-183149205 CCATTACCCTTTCCAGCCTCTGG - Intronic
966855516 3:184191329-184191351 CCTCGTCCCTTTACAGCCTGAGG - Intronic
967395589 3:189005094-189005116 TTACTACCCTTCCCAGCCTCTGG - Intronic
967440885 3:189507335-189507357 TCACTAACCTTCCCAGCCTCTGG - Intergenic
967487275 3:190047762-190047784 CCACTACCCTTTCCAGCCTCTGG - Intronic
967566734 3:190981356-190981378 GTACTACCCTTTTCAGCCTCTGG + Intergenic
967592899 3:191299369-191299391 CCAATACCCTTTGCAGCCTCTGG + Intronic
967632626 3:191763710-191763732 CCACTACCCTTCCCAGCCTCAGG + Intergenic
968330087 3:197860896-197860918 CCACTACCCTTCCCAGCCTCCGG + Intronic
969120465 4:4905277-4905299 TCACTACCCTTCCTAGCCTCTGG + Intergenic
970212481 4:13724472-13724494 CCACTACCCTTCCCAGCCTCTGG + Intergenic
970404565 4:15749988-15750010 TCACTACCCTTCCCAGCCTCTGG + Intergenic
970443073 4:16101158-16101180 CCACTACCCTGTTCAGCCTCTGG - Intergenic
970641619 4:18072714-18072736 TCACTACCATTCCCAGCCTCTGG + Intergenic
970837431 4:20427163-20427185 TCACAACCATTTACAGGCTGTGG - Intronic
970922829 4:21415107-21415129 CCACTACCCTTCCCAGCCTCTGG + Intronic
971545490 4:27880211-27880233 TCACTTCCCTGTGCAGCCTCAGG - Intergenic
971558496 4:28043811-28043833 CCACTACCCTTCCCAGCCTCTGG + Intergenic
971673785 4:29597382-29597404 TCACTACCCTTCCCAGTCTCTGG + Intergenic
972069447 4:34996834-34996856 TCATTACCCTTCCCAGCCTCTGG + Intergenic
972148596 4:36061356-36061378 TCACTACCCTTCCCAGCCTCTGG + Intronic
972269212 4:37493729-37493751 CCACTACCCTTCTCAGCCTCTGG + Intronic
972953068 4:44353620-44353642 TCATTACCCTTCCCAGCCTCTGG + Intronic
973053699 4:45628471-45628493 TCTCTACCCTTCACAGCCTCTGG + Intergenic
973215028 4:47658606-47658628 CCACTGCCCTTTGCAGCCTTAGG - Intronic
973275577 4:48303396-48303418 CCACTACCCTTCCCAGCCTCTGG - Intergenic
973762164 4:54127657-54127679 TCACTACCCTTCCCAGCCTCTGG + Intronic
974141323 4:57891553-57891575 TCACTACTCTTCCCAGCCTCTGG - Intergenic
974290571 4:59924521-59924543 TCACTACCCTTCTCAGCCGCTGG - Intergenic
974470116 4:62308770-62308792 CCACTACCTTTCACAGCCTCTGG - Intergenic
974540297 4:63225378-63225400 TCACTGCCCTTCACAGCCTTGGG + Intergenic
974661945 4:64901298-64901320 TCACTACCATTACCAGCCTCTGG - Intergenic
975035673 4:69677301-69677323 TCACTACCATTCTCAGCCTCTGG - Intergenic
975036492 4:69690533-69690555 TCACCACCCTTTCCAGCCTCTGG + Intergenic
975165014 4:71168609-71168631 CCACTACCCTTTTCATCCTCTGG + Intergenic
975212368 4:71716203-71716225 TCACTACCATTCCCAGCCTCTGG + Intergenic
975276808 4:72512105-72512127 CCACTACCCTTCCCAGCCTCTGG - Intronic
975656953 4:76651120-76651142 CCACTACCCTTCCCAGCCTATGG - Intronic
975808005 4:78133363-78133385 CCACTACCCTTCCCAGCCTCTGG - Intronic
976534908 4:86201003-86201025 CCACTACCCTTCCCAGCCTTTGG + Intronic
976666190 4:87595294-87595316 TGACTACCCTTCCCAGCCTCTGG + Intergenic
976679511 4:87739584-87739606 TCACTACCCTATCCAGGCTCTGG + Intergenic
976902651 4:90197772-90197794 CCACTACCCTTCCCAGCCTCTGG - Intronic
976953752 4:90867694-90867716 CCACTAGCCTTTCCAGCCTTTGG + Intronic
976953800 4:90868349-90868371 TTACTACCCTCTCCAGCCTTCGG + Intronic
977209856 4:94206483-94206505 ACACTACCCTTCCCAGCCTCTGG - Intergenic
977307950 4:95348958-95348980 TCACTACCCTTCCCAGCTTCTGG - Intronic
977342022 4:95771221-95771243 TCACTACCCCTCCCAGCCTCTGG - Intergenic
977419601 4:96781536-96781558 CCACTACCCTTCCCAGCCTCTGG - Intergenic
977458293 4:97291748-97291770 TCACTACTCTTCCCAGCCTCTGG + Intronic
977496949 4:97788224-97788246 CCACTACCCTTCCCAGCCTCTGG + Intronic
977631748 4:99250686-99250708 TCACCACCCTTTCCAGTCTCTGG - Intergenic
977762453 4:100755771-100755793 TCACTACTCTTCCCAGCCTCTGG - Intronic
977859414 4:101938289-101938311 TCACTACCTTTTCCAGTCTCTGG - Intronic
978029392 4:103920880-103920902 CCACTACCCTTTCCAGCCATTGG + Intergenic
978032961 4:103958502-103958524 TCAGTACCCTTCCCAGCCTCTGG - Intergenic
978045779 4:104125323-104125345 CCACTACCCTTAACAGCCTCTGG - Intergenic
978212242 4:106151359-106151381 CCACTACCCTTCCCAGCCTCTGG + Intronic
978217854 4:106228392-106228414 CCACTACCCTTCCCAGCCTGTGG + Intronic
978221393 4:106279607-106279629 CCACTACCCTTTCCAGCCTCTGG + Intronic
978743540 4:112165747-112165769 CCACTACCCTTCCCAGCCTCTGG - Intronic
979280261 4:118859572-118859594 CCACTACCCTTCCCAGCCTCTGG + Intronic
979402214 4:120262428-120262450 CCACTACCCTTCCCAGCCTCTGG - Intergenic
979422525 4:120522966-120522988 CCACTACCCTTCCCAGCCTCTGG - Intergenic
979795130 4:124836976-124836998 CCACTACCCTTCCCAGCCTCTGG + Intergenic
979847304 4:125531931-125531953 CCACTACCCTTCCCAGCCTCTGG + Intergenic
979923884 4:126535703-126535725 CCACTTCCCTTTCCAGCCTTGGG - Intergenic
980089757 4:128430507-128430529 CCACTACCCTTCCCAGCCTCTGG + Intergenic
980687102 4:136242581-136242603 TCACTACCCTTCCCAGCCTCTGG - Intergenic
981039230 4:140207459-140207481 CCACTACCCTTCTCAGCCTCTGG + Intergenic
981195750 4:141918575-141918597 TCACCACTCTTAACAGCCTCTGG - Intergenic
981203244 4:142008632-142008654 CCACTGCCCTTTTCAGCCTCTGG + Intergenic
981297565 4:143149641-143149663 CCACTATCCTTTCCAGCCTCTGG + Intergenic
981329754 4:143495018-143495040 CCACTACCCTTCCCAGCCTCTGG - Intergenic
981414833 4:144480688-144480710 TCACTACCCTTCCCAGCCTCTGG - Intergenic
981425445 4:144597358-144597380 TCACTACCCTCTACAGGTAGGGG + Intergenic
981641525 4:146949231-146949253 TCACTACCTTTCCCAGCCTCTGG + Intergenic
981738095 4:147973686-147973708 TCACTACCCTCCCCAGCCTCTGG + Intronic
981954710 4:150455814-150455836 TCACCACCCTTCCCAGCCTCTGG + Intronic
981976225 4:150731682-150731704 TCACTACCCTTCCTAGCCTCTGG - Intronic
982478730 4:155882901-155882923 TCATTACCCTTTCCAGCTTCTGG - Intronic
982540891 4:156669254-156669276 TCACTACCCTTCCCAGCCTCTGG + Intergenic
982987248 4:162225917-162225939 CCAGTACCCTTTCCAGCCTCTGG - Intergenic
983017713 4:162635012-162635034 TCACTACCTTTCCCAGCCTCTGG - Intergenic
983064436 4:163192657-163192679 TCTCAACCCTGTCCAGCCTGTGG - Intergenic
983888825 4:173010161-173010183 CCACTACCCTTGCCAGCCTCTGG + Intronic
983943005 4:173555889-173555911 CCACTACCCTTCCCAGCCTCTGG - Intergenic
984239252 4:177197914-177197936 TGACTACCCTTCCCAGCCTCTGG + Intergenic
984314391 4:178108062-178108084 TCACTACCCTTACAAGCCTCTGG - Intergenic
984505778 4:180616532-180616554 TGACTACCCTTCTCAGCCTCTGG - Intergenic
984634445 4:182095529-182095551 CCACTACCCTTCCCAGCCTCTGG - Intergenic
984634741 4:182098658-182098680 CCACTACCCTTCTCAGCCTCTGG - Intergenic
985442754 4:189996067-189996089 TCACTGCCCTTCCCAGCCTCTGG + Intergenic
985589335 5:756596-756618 CCAAAACCCTTTACAGCTTGAGG + Intronic
985604064 5:849316-849338 CCAAAACCCTTTACAGCTTGAGG + Intronic
985721708 5:1492996-1493018 TCAGCACCCTTTGCATCCTGTGG - Intronic
985950052 5:3216065-3216087 CCACTACCCTTTCCGGCCTCTGG - Intergenic
986544098 5:8876377-8876399 TCACTACCCTTTCCAGCCTCTGG + Intergenic
986630674 5:9769071-9769093 TCACTACCCTTTCCAGCCTCTGG + Intergenic
986866605 5:11996505-11996527 GCACTACCCTTCTCAGCCTCTGG + Intergenic
986898802 5:12406027-12406049 ACACTACCCTTCCCAGCCTCTGG + Intergenic
987181979 5:15377570-15377592 CCACTTCCCTTTTCACCCTGTGG - Intergenic
987189060 5:15454754-15454776 CCACTACCCTTCTCAGCCTCTGG + Intergenic
987433820 5:17868553-17868575 CCACTACCATTCCCAGCCTGTGG + Intergenic
987631949 5:20484789-20484811 CCACTACCCTTCCCAGCCTCTGG - Intronic
987773809 5:22338414-22338436 TCAGTACCCTTCCCAGCCTCTGG - Intronic
987887078 5:23826721-23826743 TCACTACCCTCCCCAGCCTCTGG + Intergenic
987912119 5:24161265-24161287 TCACTACCCTTCTCAGCCTCTGG - Intronic
987980259 5:25075023-25075045 TCACTACCCTTTTCAGCTTCTGG + Intergenic
988217533 5:28294440-28294462 CCACTACCCTTCCCAGCCTCTGG + Intergenic
988810065 5:34776251-34776273 CCACTACCCTTCCCATCCTGTGG - Intronic
989044792 5:37264266-37264288 TCACTACCCTTCCAAGCCTCTGG + Intergenic
989491964 5:42067350-42067372 TCACTACCCTTCTCAGACTCTGG + Intergenic
989553748 5:42766749-42766771 CCACTACCCTTCCCAGCCTCTGG - Intronic
989630026 5:43472784-43472806 CCACCACCCTTCACAGCCTCTGG - Intronic
989683221 5:44054255-44054277 CCACTACCCTTCCCAGCCTCTGG - Intergenic
990004234 5:50926402-50926424 CCACTACCCTTTCCAGCCTCTGG - Intergenic
990073797 5:51817522-51817544 TCATCACCCTTTACAGCCCTGGG - Intergenic
991012024 5:61893148-61893170 CCACTACCCTTTCCAGCCCCTGG - Intergenic
991922699 5:71672494-71672516 CCACTACCCTTCCCAGCCTCTGG + Intergenic
991938046 5:71822063-71822085 CCACTACCCTTCTCAGCCTCTGG + Intergenic
992091774 5:73323938-73323960 CCACTACCCTTCCCAGCCTCTGG - Intergenic
992320057 5:75605068-75605090 ATACTACACTTTACAGGCTGAGG - Intergenic
993026411 5:82652215-82652237 CAACTACCCTCCACAGCCTGTGG + Intergenic
993139121 5:84008120-84008142 CTACTACCCTTTCCAGCCTCTGG - Intronic
993155775 5:84219940-84219962 GCACTACCCTTTTCAGCCTCTGG - Intronic
993268750 5:85764960-85764982 CCACTACGCTTCACAGCCTGTGG + Intergenic
993276361 5:85864825-85864847 TCCCTACCCTTACCAGCCTTTGG - Intergenic
993646521 5:90470193-90470215 CCCCTACCCTTTCCAGCCTCTGG - Intronic
993950218 5:94165844-94165866 TCACTACTCTTCCCAGCCTCTGG - Intronic
994596735 5:101847604-101847626 CCACTACCCTTCTCAGCCTCTGG + Intergenic
994635793 5:102343207-102343229 ACACTACCCCTTAAAGCCAGAGG - Intergenic
994893110 5:105664768-105664790 TCACTACCATTGCCAGCCTCTGG + Intergenic
995188601 5:109297505-109297527 CCACTACCCTTTCCAGCCTCTGG - Intergenic
995322127 5:110847389-110847411 TTACTACCCTTGCCAGCCTCTGG + Intergenic
995558110 5:113351531-113351553 CCACTACCCTTTCCAGCTTCTGG - Intronic
995673384 5:114633496-114633518 TCACTTCCCTTCCCAGCCTCTGG + Intergenic
995685643 5:114769044-114769066 TCACTACCCTTCCCAGCCTCTGG + Intergenic
995771134 5:115671678-115671700 TCACTACTCTTCACACCCTCTGG - Intergenic
996175338 5:120349556-120349578 CTACTACCCTTTCCAGCCTCTGG + Intergenic
996189694 5:120524515-120524537 ACACTACCCTTCCCAGCCTATGG - Intronic
996192160 5:120558298-120558320 CAACTACCCTTTTCAGCCTCTGG + Intronic
996298684 5:121955149-121955171 CCACTACCCTTCTCAGCCTCTGG + Intergenic
996931140 5:128889694-128889716 CCACTACCCTTCTCAGCCTCTGG + Intronic
997174692 5:131763008-131763030 CCACTACCCTTCTCAGCCTGTGG - Intronic
997417071 5:133737255-133737277 CCACTACCCTTCCCAGCCTCTGG + Intergenic
997789715 5:136747302-136747324 CTACTACCCTTTCCAGCCTCTGG - Intergenic
997833060 5:137169174-137169196 TCACAACACTTTCCAGCCTTTGG - Intronic
997865998 5:137463506-137463528 CCACTACCCTTGCCAGCCTCTGG - Intronic
998634417 5:143937174-143937196 ACACTACCCATCACAGCCTCTGG - Intergenic
998698033 5:144663275-144663297 CCACTACCCTTCCCAGCCTCTGG - Intergenic
998910067 5:146949960-146949982 CCACTACCCTTCCCAGCCTCTGG - Intronic
999455307 5:151710728-151710750 TCACTACCCTTCCCAGCTTCTGG + Intergenic
1000244122 5:159434938-159434960 TGACTACCCTTCCCAGCCTCTGG + Intergenic
1000341860 5:160283771-160283793 CCACTACCCTTCCCAGCCTTTGG + Intronic
1000531923 5:162433347-162433369 CCACTAACCTTTCCAGCCTCTGG + Intergenic
1000784613 5:165528414-165528436 TCACTGCTCTATGCAGCCTGAGG + Intergenic
1000890698 5:166798407-166798429 TCACTACACTTGCCAGCCTCTGG + Intergenic
1001178226 5:169493064-169493086 TTACTACTCTTTCCAGCCTCTGG - Intergenic
1001365022 5:171128497-171128519 TCCCTTCCCTTTGCAGCCTCTGG - Intronic
1002736447 5:181391407-181391429 CCACTACCCTTCACAGCCTCTGG + Intergenic
1002748250 6:83417-83439 CCACTACCCTTCACAGCCTCTGG - Intergenic
1003434644 6:6074642-6074664 CCCCTACCCTTTCCAGCCTCTGG + Intergenic
1004330690 6:14717782-14717804 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1004635962 6:17467963-17467985 CCACTACCCTTCCCAGCCTTTGG + Intronic
1004912088 6:20296035-20296057 TCATTACCCTTCCCAGCCTCTGG + Intergenic
1005215939 6:23528055-23528077 TCACTACCCTTCCCAGCTTCTGG - Intergenic
1005280331 6:24267146-24267168 TCACTACCCTTCCCAGCCTCTGG - Intronic
1006059075 6:31405713-31405735 CCACTACCCTTCTCAGCCTCTGG + Intronic
1006071560 6:31500597-31500619 CCACTACCCTTCTCAGCCTCTGG + Intronic
1006340056 6:33441926-33441948 TGAGAGCCCTTTACAGCCTGAGG + Intronic
1006974666 6:38088382-38088404 TCAGTACCCTTCCCAGCCTCTGG - Intronic
1007552132 6:42738272-42738294 CCACTACCCTTCCCAGCCTATGG - Intergenic
1008172861 6:48231698-48231720 CCACTACCCTTTCCAGCCTCAGG + Intergenic
1008186207 6:48394177-48394199 CCACTACCCTTTCCATCCTCTGG - Intergenic
1008836463 6:55837809-55837831 CCACTACCCTTCCCAGCCTCTGG + Intronic
1009540934 6:64957418-64957440 CCACTACCCTTCCCAGCCTCTGG - Intronic
1009769759 6:68130262-68130284 ACACTACCCTTGCCAGCTTGTGG + Intergenic
1010155746 6:72790491-72790513 TCACTACCCTTTCCAGCCTCTGG - Intronic
1010303674 6:74290742-74290764 TCACTACCCTTCCCAGTCTCTGG + Intergenic
1010328502 6:74593378-74593400 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1010363218 6:75018891-75018913 ACACTACCCTTGCCAGCCTCTGG + Intergenic
1010514600 6:76758216-76758238 TCACTACCCTTACCAACCTCCGG - Intergenic
1010920576 6:81674957-81674979 CCACTACCCTTCCCAGCCTTTGG - Intronic
1011434165 6:87320002-87320024 CCACTACCCTTCCCAGCCTCTGG - Intronic
1011520976 6:88205760-88205782 TCACTACCCTTTCCATCTTCTGG - Intergenic
1012180776 6:96149998-96150020 CCATTACCCTTCCCAGCCTGTGG + Intronic
1012202370 6:96422885-96422907 TCACTTCCCTTCCCAGCCTCTGG + Intergenic
1012503853 6:99921773-99921795 CTACTACCCTTTCCAGCCTCTGG + Intronic
1012537763 6:100319853-100319875 CCACTACCCTTCACATCCTCTGG + Intergenic
1012712420 6:102624441-102624463 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1012892828 6:104916467-104916489 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1013184285 6:107744737-107744759 CCACTTCCCTCTGCAGCCTGGGG + Intronic
1013257040 6:108397615-108397637 CCACTACCCTTCCCAGCCTCTGG + Intronic
1013292321 6:108729990-108730012 TCAGGACCCTTTCCACCCTGGGG - Intergenic
1013687804 6:112605831-112605853 ACACTACCCTTCACAGCCTCTGG - Intergenic
1014051004 6:116954291-116954313 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1014355174 6:120399596-120399618 GCACTACCCTTCCCAGCCTCTGG + Intergenic
1014518985 6:122415512-122415534 TCACTACCCTTTATTTCCTAAGG + Intronic
1015393280 6:132707762-132707784 TAACTACCCTTCCCAGCCTCTGG - Intronic
1016456876 6:144240080-144240102 TCACTATCCTTCCCAGCCTCTGG + Intergenic
1016483770 6:144512004-144512026 TCACTGCCCTACACATCCTGAGG - Intronic
1016567253 6:145470012-145470034 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1016589470 6:145728929-145728951 TCACTACCCTGTACAACCTCAGG + Intronic
1017063186 6:150505958-150505980 TCACTACCCTTTCCAGCCTTTGG - Intergenic
1017388210 6:153909956-153909978 ACACTACCCTTCCCAGCCTCTGG - Intergenic
1017400056 6:154050591-154050613 CCACTACCCTTTCCAGCCTCTGG - Intronic
1019241545 6:170666936-170666958 CCACTACCCTTCACAGCCTCTGG + Intergenic
1020041705 7:5008407-5008429 CCACTACCCTTCCCAGCCTCTGG + Intronic
1020483042 7:8685762-8685784 TCACTACCCTTCCCAGGCTCTGG - Intronic
1020503274 7:8951229-8951251 TCACTACTCTTCCCAGCCTCTGG - Intergenic
1020515549 7:9113543-9113565 TCACTTCCCTTCCCAGCCTCTGG - Intergenic
1020577289 7:9949342-9949364 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1020612940 7:10423435-10423457 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1020676758 7:11192835-11192857 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1021582756 7:22174528-22174550 TCACTCACTTTTACTGCCTGTGG + Intronic
1021610133 7:22449293-22449315 ACACTACCCTTCCCAGCCTCTGG + Intronic
1021843272 7:24740271-24740293 CCACTACCCTTCCCAGCCTCTGG - Intronic
1021956353 7:25828811-25828833 ACACTACCCTTCCCAGCCTCTGG - Intergenic
1022118886 7:27287691-27287713 CCACTAGCCTTCCCAGCCTGTGG - Intergenic
1022368227 7:29746249-29746271 CAACTACCCTTCCCAGCCTGTGG - Intergenic
1022758443 7:33320239-33320261 CCACTACCCTTCCCAGCCTCTGG + Intronic
1022853323 7:34289417-34289439 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1022929919 7:35100550-35100572 TCACTATCCTTCCCAGCCTCTGG - Intergenic
1022972598 7:35531205-35531227 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1023163163 7:37317663-37317685 CCACTACCCTTCACAGCTTCTGG - Intronic
1023189653 7:37566249-37566271 TCACTGCCCTTCCCAGCCTCTGG + Intergenic
1023265268 7:38398534-38398556 TCACTACCCTTCCCAGCCTCTGG - Intronic
1023275143 7:38510740-38510762 TCATCATCCTTTACAGCCTGGGG - Intronic
1023347067 7:39281457-39281479 TCCCTCCCCTTTCCAGCCTCTGG + Intronic
1024014885 7:45304653-45304675 TCACTACCCTTGCCAGTCTCTGG + Intergenic
1024285389 7:47752898-47752920 CCACTACCCTTTCTAGCCTCTGG + Intronic
1024336102 7:48206968-48206990 CCACTACCCTTCTCAGCCTCTGG + Intronic
1024412112 7:49055837-49055859 TCCCTACCTTTTATAGCCTCTGG + Intergenic
1024798398 7:53046985-53047007 CCACTACCATTTGCAGCCTCTGG - Intergenic
1025029158 7:55542415-55542437 CCACTACCCTTTCCAGCCTCTGG + Intronic
1025826186 7:65012806-65012828 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1025913744 7:65849272-65849294 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1025973046 7:66345977-66345999 CCACTACCCTTCCCAGCCTTTGG + Intronic
1025975812 7:66368774-66368796 CCACTACCCTTCCCAGCCTCTGG + Intronic
1026072921 7:67138626-67138648 CCACTACCCTTCCCAGCCTCTGG + Intronic
1026499302 7:70929604-70929626 TCCCTACCCTTTCCAGCCTCTGG + Intergenic
1026663493 7:72322652-72322674 CCACTACCCTTCCCAGCCTCTGG - Intronic
1026703959 7:72673590-72673612 CCACTACCCTTCCCAGCCTCTGG - Intronic
1027433098 7:78134474-78134496 TCACTACTCTTTTGAGCCTCAGG + Intronic
1027826892 7:83126216-83126238 CCACTATCCTTCCCAGCCTGTGG - Intronic
1027918073 7:84352219-84352241 CCACTAACCTTTCCAGCCTCTGG - Intronic
1027968733 7:85048618-85048640 GAACTACCCTTTTTAGCCTGTGG + Intronic
1028161483 7:87491123-87491145 CCACTACCCTTCATAGCCTCTGG - Intergenic
1028176153 7:87661416-87661438 TCACTACCCTCCCCAGCCTCTGG + Intronic
1028266012 7:88726543-88726565 CCATTACCCTTCACAGCCTTAGG + Intergenic
1028299083 7:89174245-89174267 TCACTACCCTTCCCAGCCTCTGG + Intronic
1028512020 7:91635659-91635681 CGACTACCCTTCCCAGCCTGTGG - Intergenic
1028595481 7:92543936-92543958 CTACTACCCTTTCCAGCCTCTGG - Intergenic
1028973269 7:96883274-96883296 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1029042116 7:97587026-97587048 CCGCTACCCTTTCCAGCCTCTGG + Intergenic
1029345211 7:99973504-99973526 CCACTACCCTTCCCAGCCTTTGG - Intronic
1029825813 7:103192994-103193016 TCACTATCCTTCCCAGCCTCTGG - Intergenic
1030480617 7:110099201-110099223 TCATTACCCTTCCCAGCCTCTGG - Intergenic
1030662972 7:112241842-112241864 CCACTACCCTTCCCAGCCTCTGG - Intronic
1030733924 7:113021485-113021507 CTACTACCCTTTTCAGCCTCTGG + Intergenic
1030844816 7:114396165-114396187 CCACTACCCTTTGCAGCCTCTGG + Intronic
1030883384 7:114909403-114909425 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1031078418 7:117234738-117234760 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1031174859 7:118337615-118337637 TCACTACCTTTCCCAGCCTATGG + Intergenic
1031190659 7:118545464-118545486 TCACTACACTTCCCAGCCTCTGG - Intergenic
1031280047 7:119787814-119787836 TCACTACCCTTTTCAGCCTCTGG - Intergenic
1031306730 7:120137359-120137381 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1031387417 7:121168733-121168755 CCACTACCCTTTTCAGCCTTTGG + Intronic
1031708484 7:125013361-125013383 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1031726734 7:125249321-125249343 CCACTACCCTTCCCAGCCTCAGG + Intergenic
1031787199 7:126047533-126047555 TCACTACCCTTCACAGCCTCGGG - Intergenic
1031788385 7:126064961-126064983 CTGCTACCCTTTCCAGCCTGTGG - Intergenic
1031926114 7:127640265-127640287 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1031950757 7:127889674-127889696 TCACTACCCCTCCCAGCCTTTGG + Intronic
1032001698 7:128270040-128270062 CCACTACCCTTTCCAGTCTCTGG - Intergenic
1032014693 7:128371076-128371098 CCACTACCATTTCCAGCCTCTGG - Intergenic
1032138121 7:129300292-129300314 TCACTACCCTTCCCAACCTTTGG + Intronic
1033063483 7:138129702-138129724 CCACTACCCTGTACAACCTTGGG - Intergenic
1033270161 7:139923795-139923817 TCACTACTCTTCCCAGCCTCTGG + Intronic
1033509204 7:142038054-142038076 TCACTACCCTTCCCAGCCTCTGG + Intronic
1033877051 7:145834429-145834451 TCACTACCCCTTCCAGCCTCTGG + Intergenic
1033920798 7:146388759-146388781 CCACTACCCTTTTCAGCATCTGG + Intronic
1034019339 7:147625096-147625118 TCACTACCCTTCCCAGCCTCTGG - Intronic
1034642115 7:152612454-152612476 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1035506571 8:141160-141182 CCACTACCCTTCACAGCCTCTGG - Intergenic
1036943976 8:13077099-13077121 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1037339759 8:17831896-17831918 GCCCTACCCTTTCCAGCCTCTGG + Intergenic
1037389306 8:18376493-18376515 TCCCTACCCTTTCCAGCCTCTGG - Intergenic
1037586846 8:20282818-20282840 TCACTGATCTTTACACCCTGGGG + Intronic
1037872830 8:22515121-22515143 TTACTACCCTTCCCAGCCTCTGG + Intronic
1038892897 8:31747000-31747022 CCACTACCCTTCCCAGCCTCTGG - Intronic
1039150941 8:34504782-34504804 CCACTACCCTTCGCAGCCTCTGG - Intergenic
1039610656 8:38916415-38916437 CCACTACCCTTCCCAGCCTCTGG + Intronic
1039650592 8:39336989-39337011 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1040048635 8:42989736-42989758 CCACTACCCTTCCCAGCCTCTGG + Intronic
1041078017 8:54186809-54186831 TCACTCCCCTATACCTCCTGAGG - Intergenic
1041084356 8:54243209-54243231 TCAAAGCCCTTTTCAGCCTGGGG - Intergenic
1041510310 8:58648617-58648639 CCACTACCCCATACAGCCTAGGG + Intronic
1041556627 8:59164485-59164507 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1041626731 8:60037789-60037811 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1041785202 8:61624008-61624030 TCACTACCCTTCCCAACCTCTGG - Intronic
1042074861 8:64981266-64981288 TCACTACCTTCTCCAGCCTCTGG - Intergenic
1042099557 8:65260084-65260106 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1042358483 8:67855342-67855364 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1042722110 8:71837367-71837389 TCACTACCTTTCCCAGCCTCTGG - Intronic
1042986679 8:74592108-74592130 TCACTACCCCTTCCAGCCTCTGG + Intergenic
1043554687 8:81417431-81417453 TCACTACCCTTCCCAGCCTCAGG - Intergenic
1043612625 8:82083921-82083943 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1043739756 8:83796073-83796095 ACACTACCCTTCCCAGCCTCTGG + Intergenic
1044403850 8:91803708-91803730 ACAATACCCTTCACAGCCTCTGG - Intergenic
1044990325 8:97789867-97789889 CCACTACCCTTCCCAGCCTCTGG + Intronic
1045995242 8:108354244-108354266 TCACTACCCTTCCCAGTCTCTGG - Intronic
1046147421 8:110179293-110179315 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1046211183 8:111079326-111079348 TCACTACCCTTCCTAGCCTCTGG + Intergenic
1046368829 8:113272839-113272861 CCACTACCCTTCCCAGCCTCTGG - Intronic
1047584237 8:126252178-126252200 ACACTACCCTTTCCAGTCTCTGG - Intergenic
1048060370 8:130913340-130913362 CCACTACCCTTCCCAGCCTCTGG + Intronic
1048105801 8:131407826-131407848 CCACTACCCTTTTCAGCCTCTGG + Intergenic
1048418020 8:134248826-134248848 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1048549295 8:135419057-135419079 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1048608336 8:135993854-135993876 CCACTACCCTTCCCAGCCTCAGG - Intergenic
1048690563 8:136957926-136957948 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1048883219 8:138887197-138887219 TCACTATCCTTCCCAGACTGTGG + Intronic
1049209775 8:141380408-141380430 TCACTCCACTTAGCAGCCTGAGG - Intergenic
1049953067 9:664226-664248 CCACTACCCTTCCCAGCCTCCGG + Intronic
1050145489 9:2562915-2562937 TCACTACCCTTCACAGCCTCTGG - Intergenic
1050276572 9:4007336-4007358 TCATTTCCCTCTTCAGCCTGAGG - Intronic
1050313081 9:4372889-4372911 TCACTGCCCATTAGAGGCTGGGG - Intergenic
1050906030 9:11007353-11007375 TCACTACCATTCACAGCCTCTGG + Intergenic
1051123802 9:13780914-13780936 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1051345719 9:16149016-16149038 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1051432711 9:16996574-16996596 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1051941440 9:22510134-22510156 TCACTACCATTCCCAGCCTCTGG - Intergenic
1052094931 9:24372332-24372354 TCACTACCATTTCCAGCCTCTGG - Intergenic
1052214148 9:25944908-25944930 TCACTACCCTTCCTAGCCTCTGG + Intergenic
1052539327 9:29787702-29787724 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1052564703 9:30134459-30134481 TCACTACCCCCAACATCCTGTGG - Intergenic
1052579573 9:30337917-30337939 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1052607662 9:30725338-30725360 TCACTACTCTTCTCAGCCTCTGG - Intergenic
1052666905 9:31507113-31507135 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1055243292 9:74210788-74210810 CCACTACTCTTTCCAGCCTCTGG + Intergenic
1055419234 9:76119950-76119972 TCACCACCCTTCCCAGCCTCTGG + Intronic
1055692040 9:78843110-78843132 CCACTACACTTTGCAGCCTCTGG + Intergenic
1055885697 9:81060985-81061007 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1056009582 9:82313110-82313132 CCACTACCCTTTCCAGCCCCTGG - Intergenic
1056067971 9:82956665-82956687 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1056180527 9:84078183-84078205 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1056183880 9:84112396-84112418 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1056228749 9:84523433-84523455 CCACTACCCTTCTCAGCCTCTGG + Intergenic
1056252568 9:84765046-84765068 TCACTACCCTTCCCAGCCTCTGG - Intronic
1056697199 9:88869678-88869700 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1057294496 9:93827427-93827449 TCACTGCCCTTCACTGCCCGTGG - Intergenic
1057664653 9:97035723-97035745 TCACTACCATCTACCTCCTGGGG + Intronic
1057706622 9:97399446-97399468 ACACTGCCCTTTGGAGCCTGCGG - Intergenic
1057970061 9:99546226-99546248 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1058144406 9:101395753-101395775 TCACTACCCTTCCCAGCCTCTGG - Intronic
1058220823 9:102299286-102299308 TCACTACCCTTCTCAGCCTCTGG + Intergenic
1058256636 9:102774734-102774756 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1058377103 9:104335487-104335509 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1058842931 9:108927878-108927900 TCACTACCCTTCCCAGCCTCTGG - Intronic
1058859677 9:109103723-109103745 TCACTATCCTTCCCAGCCTCTGG - Intronic
1059030067 9:110683128-110683150 GTACTACCCTTTCCAGCCTCTGG + Intronic
1059042034 9:110825521-110825543 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1059075546 9:111189796-111189818 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1059401089 9:114071041-114071063 CCACACCCCTTTGCAGCCTGAGG - Intronic
1059500096 9:114745042-114745064 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1060019550 9:120117346-120117368 CCACTGCCCTGTACAGCCTCAGG + Intergenic
1060762770 9:126270047-126270069 ACACTACCCTTCCCAGCCTCTGG - Intergenic
1061004244 9:127919425-127919447 TCACTTTCCTTTCCAGCCTGAGG + Intergenic
1061193707 9:129096187-129096209 TCCCTGCCCTCTTCAGCCTGTGG + Intronic
1061979196 9:134090421-134090443 TCACTACCCTGAACGGCCTTGGG - Intergenic
1203601737 Un_KI270748v1:16170-16192 CCACTACCCTTCACAGCCTCTGG + Intergenic
1186017646 X:5215726-5215748 TCACTACTCTTTTCAGCCACTGG - Intergenic
1186065343 X:5757799-5757821 TCTCTACCCTTCCCAGCCTCTGG - Intergenic
1186140338 X:6565269-6565291 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1186269415 X:7868803-7868825 CAACTACCCTTCCCAGCCTGTGG + Intergenic
1186601629 X:11043938-11043960 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1186657169 X:11625524-11625546 CCACTACCCTTCCCAGCCTCTGG - Intronic
1186692141 X:11989473-11989495 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1186840541 X:13480573-13480595 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1186929732 X:14375455-14375477 CCACCACCCTTTCCAGCCTCTGG - Intergenic
1187039892 X:15582696-15582718 CCACTACTCTTTCCAGCCTCTGG - Intronic
1187095678 X:16145486-16145508 CCACTACCCTTCTCAGCCTCTGG - Intronic
1187192709 X:17051011-17051033 CCACTACCCCTCACAGCCTCTGG + Intronic
1187223953 X:17357831-17357853 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1187670443 X:21661030-21661052 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1187837741 X:23452724-23452746 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188027804 X:25229143-25229165 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1188068443 X:25690336-25690358 CCACTATCCTTTCCAGCCTCTGG + Intergenic
1188202631 X:27309835-27309857 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188206089 X:27360123-27360145 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1188229129 X:27639278-27639300 TCACTACTCTTCCCAGCCTCTGG - Intronic
1188466108 X:30483092-30483114 TCCCTACCCTTCCCAGCCTGTGG - Intergenic
1188474763 X:30579549-30579571 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188579654 X:31695260-31695282 ACACTACCCTTTGTAGCCTCTGG - Intronic
1188625506 X:32279653-32279675 CCACTACCCTTCACAGCCTCTGG - Intronic
1188692235 X:33144260-33144282 CCACTACCCTTCCCAGCCTCTGG - Intronic
1188720064 X:33511255-33511277 CGACTACCCTTCTCAGCCTGCGG + Intergenic
1188730703 X:33642419-33642441 CCACTACCCTTTCCAGCATCTGG - Intergenic
1188745198 X:33832758-33832780 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188753135 X:33927884-33927906 TCATTACCCTTCCCAGCCTCTGG - Intergenic
1188788268 X:34375839-34375861 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1188794622 X:34446615-34446637 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188845466 X:35066519-35066541 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1188871015 X:35372297-35372319 ACACTACCCTTCCCAGCCTCTGG + Intergenic
1188889586 X:35593900-35593922 TCACTACCCTTCCCAGCCTCTGG - Intergenic
1188916463 X:35917465-35917487 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1188942920 X:36262369-36262391 CCACTACCCTTCCCAGCCTCTGG + Intronic
1188957647 X:36452697-36452719 TCACTACCCTTACCATCCTCTGG - Intergenic
1188971688 X:36625165-36625187 TCACTACCCTTCCCACCCTCTGG + Intergenic
1188974804 X:36660373-36660395 CCACTACCCATCACAGCCTCCGG - Intergenic
1188977616 X:36694036-36694058 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1189034939 X:37486222-37486244 CCACTACCATTTCCAGCCTATGG - Intronic
1189084344 X:38004765-38004787 TCACTACCCTTCCCAGCCTCTGG - Intronic
1189087428 X:38040476-38040498 ACACTACCCTTTCCAGCCTCTGG + Intronic
1189088849 X:38056113-38056135 CCACTACCCTTCCCAGCCTCTGG + Intronic
1189113221 X:38315553-38315575 CCACTACCCTTTCTAGCCTTTGG - Intronic
1189384872 X:40529085-40529107 CCTCTACCCTTTCCAGCCTCTGG - Intergenic
1189527969 X:41846415-41846437 CAACTACCCTTTCCAGCCTCTGG - Intronic
1189541181 X:41991621-41991643 TCCCTACCCTTCCCAGCCTCTGG - Intergenic
1189577576 X:42370981-42371003 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1189587950 X:42480121-42480143 CCACTACCCTTCTCAGCTTGTGG - Intergenic
1189850156 X:45169681-45169703 TCACTGTGCTTTACAGGCTGTGG + Intronic
1189873709 X:45411884-45411906 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1189887818 X:45566905-45566927 CCACTACCCTTCAAAGCCTGTGG - Intergenic
1190373856 X:49769417-49769439 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1190480146 X:50869212-50869234 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1190522795 X:51297409-51297431 TCACTACCCTTCTCACCCTCTGG - Intergenic
1190539098 X:51458838-51458860 TCTCAACCCTGTCCAGCCTGTGG + Intergenic
1190602499 X:52107198-52107220 CCACTACCCTTCCCAGACTGTGG + Intergenic
1190615844 X:52230115-52230137 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1190641980 X:52488641-52488663 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1190645692 X:52524225-52524247 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1190677810 X:52797122-52797144 CCACCACCGCTTACAGCCTGGGG - Intronic
1190799915 X:53778290-53778312 TCACTACCCTTCCCAGCCTCTGG + Intergenic
1190809120 X:53866405-53866427 CTACTACCCTTTCCAGCCTCTGG - Intergenic
1190853147 X:54266285-54266307 CCACTACCCTTCCCAGCCTCTGG - Intronic
1190898397 X:54643776-54643798 CCACTACCCTTGCCAGCCTCTGG + Intergenic
1191081453 X:56514632-56514654 TCACGACCCTTCTCAGCCTCTGG - Intergenic
1191130798 X:57007767-57007789 TCACCACCATTTCCAGCCTCTGG + Intergenic
1191147653 X:57185238-57185260 GCACTACCCTTCCCAGCCTCTGG + Intergenic
1191163316 X:57359191-57359213 TCACTACCCTTACCAGCCTCTGG + Intronic
1191924012 X:66289064-66289086 TCACTACCCTTTCTAGCCTCTGG + Intergenic
1192029873 X:67498453-67498475 CCACTATCCTTTCCAGCCTCTGG - Intergenic
1192067981 X:67906363-67906385 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1192227639 X:69240311-69240333 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1192308438 X:69988241-69988263 TCATTATCCTTTCCAGCCTCTGG - Intronic
1192484976 X:71517176-71517198 CCACTACCCTTCCCAGCCTCTGG - Intronic
1192504656 X:71674114-71674136 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1192530670 X:71881075-71881097 CCACTACCCTTTCCAGCCTATGG - Intergenic
1192680670 X:73250524-73250546 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1192725392 X:73745729-73745751 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1192889488 X:75373992-75374014 CCACTACCCTTCCCAGCCTCTGG + Intronic
1193098973 X:77585979-77586001 CCACTACCCTTCCCAGCCTGTGG - Intronic
1193152832 X:78142374-78142396 CCACTATCCTTTCCAGCCTCTGG + Intergenic
1193248254 X:79256460-79256482 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1193248304 X:79257214-79257236 TCACTACCCTTCAAAGCCTCTGG - Intergenic
1193268455 X:79501261-79501283 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1193487973 X:82110554-82110576 CCACTACACTTTACAGGCTCTGG + Intergenic
1193529058 X:82632214-82632236 TTACTACCCTTTCCAGCCTCTGG - Intergenic
1193541598 X:82779639-82779661 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1193674059 X:84425796-84425818 CCACTACCCTTCCCAGCCTCTGG - Intronic
1193676668 X:84462510-84462532 ACACTACTCTTTCCAGCCTCTGG - Intronic
1193681930 X:84532088-84532110 CCACTACTCTTTCCAGCCTCTGG + Intergenic
1193725078 X:85028687-85028709 TCACTATCCTTCCCAGCCTCTGG + Intronic
1193739391 X:85199793-85199815 CCACTACCCTTCACAGCCTCTGG - Intergenic
1193835944 X:86343899-86343921 CCACTACCCTTCCCAGCCTCTGG - Intronic
1193891225 X:87048183-87048205 ACACTACCCTTTTCAGCCTCTGG + Intergenic
1193925040 X:87474457-87474479 CCACTACCCTTACCAGCCTCTGG - Intergenic
1193931067 X:87552795-87552817 TCACTATCCTTCCCAGCCTCTGG - Intronic
1194164049 X:90491645-90491667 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1194246553 X:91519162-91519184 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1194338179 X:92675505-92675527 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1194379130 X:93173249-93173271 TCACTACCCTTCTCAGCCACTGG - Intergenic
1194431969 X:93819506-93819528 ACACTACCCTTTCCAGACTCTGG - Intergenic
1194471822 X:94306169-94306191 ACACTACCCTTCCCAGCCTCTGG - Intergenic
1194499918 X:94669563-94669585 TCACTACTCTTTTCAGGCTCTGG + Intergenic
1194514551 X:94835650-94835672 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1194586350 X:95739222-95739244 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1194616981 X:96116687-96116709 TGACTACCCTTCCCAGCCTCTGG + Intergenic
1194754548 X:97723004-97723026 GCACTACCCTTCTCAGCCTTTGG + Intergenic
1194770277 X:97894694-97894716 TCACTACCCTTCCCAGACTCTGG + Intergenic
1194774788 X:97949060-97949082 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1194783324 X:98051427-98051449 GCACTACCCTTTCCAGCCACTGG + Intergenic
1195101361 X:101557214-101557236 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1195116438 X:101703667-101703689 TCACTTCTCTTTCCAGCCTCTGG - Intergenic
1195168259 X:102241199-102241221 ACACTACCCTTCCCAGCCTCTGG + Intergenic
1195190598 X:102445888-102445910 ACACTACCCTTCCCAGCCTCTGG - Intronic
1195218445 X:102722821-102722843 CCAATACCCTTTCCAGCCTTTGG - Intronic
1195495717 X:105530733-105530755 CCACTACCCTTCCCAGCCTCTGG + Intronic
1195547685 X:106131364-106131386 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1195781930 X:108476581-108476603 TCACTACCCTTCCCAGCCTCTGG + Intronic
1196003443 X:110810708-110810730 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1196056885 X:111365627-111365649 CCACTACCCTTAACAGCCTCTGG + Intronic
1196135458 X:112204660-112204682 TCACTACCCATCCCAGCCTCTGG - Intergenic
1196215144 X:113041864-113041886 CCACTACACTTTGCAGCCTCCGG + Intergenic
1196322443 X:114357320-114357342 TGACTACCCTTCCCAGCCTCTGG - Intergenic
1196357112 X:114808120-114808142 CCACTACCCTTCCCAGCCTCTGG + Intronic
1196401382 X:115320516-115320538 CCACTACCCTTCACAGCCTCTGG - Intergenic
1196470874 X:116024939-116024961 CCACTACCCTTTCCAGCCTCTGG - Intergenic
1196509504 X:116491206-116491228 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1196517413 X:116629750-116629772 TCACTACTCTTCTCAGCCTCTGG + Intergenic
1196517980 X:116635977-116635999 TCACTACCCTTTCCAGCCTCTGG - Intergenic
1196598784 X:117576832-117576854 CCACTTCCCTTTCCAGCCTCTGG + Intergenic
1196660865 X:118267413-118267435 TCACTACCCTTCCCAGTCTCTGG - Intergenic
1196882892 X:120215138-120215160 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1196883185 X:120218994-120219016 CCTCTACCCTTCACAGCCTCTGG - Intergenic
1196983970 X:121247550-121247572 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1197019429 X:121668852-121668874 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1197105826 X:122714220-122714242 CCACTACCCTTTCCAGTCTCTGG - Intergenic
1197286270 X:124598731-124598753 CCACTACCCTTCCCAGCCTCTGG - Intronic
1197440485 X:126482476-126482498 TCACTACACTTCCCAGCCTCTGG - Intergenic
1197441103 X:126492466-126492488 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1197519568 X:127480617-127480639 TCAATACCCTTTCCAGCCTCTGG + Intergenic
1197621652 X:128757263-128757285 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1197796439 X:130303990-130304012 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1197841784 X:130755876-130755898 CCACTACCCTTCCCAGCCTCTGG + Intronic
1197876060 X:131108383-131108405 CCACTTCCCTTTACAGCCTCTGG + Intergenic
1197986763 X:132274360-132274382 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1197999380 X:132416420-132416442 TCACTACCCTTTCTAGCCTCTGG - Intronic
1198316020 X:135467230-135467252 TGACTACCCTTCCCAGCCTCAGG - Intergenic
1198366334 X:135943746-135943768 TCACTAACCTTCCCAGCCTCTGG - Intergenic
1198514654 X:137393614-137393636 TCACTAACCTTCCCAGCCTCTGG + Intergenic
1198717040 X:139568692-139568714 CCACTACGCTTTCCAGCCTCTGG - Intergenic
1198871951 X:141185352-141185374 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1198925231 X:141783939-141783961 TCACTACCCTTTCCAGCCTGTGG + Intergenic
1198938432 X:141925207-141925229 CCATTACCCTTTCCAGCCTCTGG + Intergenic
1198950871 X:142070716-142070738 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1198953037 X:142094713-142094735 ACACTACCCTTTCCAGCCTCTGG - Intergenic
1198981362 X:142399959-142399981 CTACTACCCTTCACAGCCTCTGG + Intergenic
1199034441 X:143033511-143033533 CCACTACCACTTACAGGCTGGGG + Intronic
1199114157 X:143970274-143970296 TCACCACACTTTCCAGCCTCTGG + Intergenic
1199140989 X:144312073-144312095 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1199176471 X:144793407-144793429 CCACTACCCTTATCAGCCTCTGG - Intergenic
1199194452 X:145010871-145010893 TCACTACCCTTCCCAGCCTTTGG - Intergenic
1199358722 X:146892063-146892085 CCACTACCCTTCTCAGCCTCTGG - Intergenic
1199442687 X:147886326-147886348 CCACTACCCTTTGCAGCCTCTGG + Intergenic
1199795742 X:151194124-151194146 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1199925307 X:152456663-152456685 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1200383385 X:155864126-155864148 CCACTACCCTTTTCAGCCTCTGG + Intergenic
1200510309 Y:4069454-4069476 CCACTACCCTTCCCAGCCTCTGG - Intergenic
1200565515 Y:4760406-4760428 CCACTACCCTTTCCAGCCTCTGG + Intergenic
1200646583 Y:5792283-5792305 CCACTACCCTTCCCAGCCTCTGG + Intergenic
1200648223 Y:5811127-5811149 CCACTACTCTATACAGCCTTGGG - Intergenic
1201650668 Y:16282358-16282380 TCACTACCCTCTTCAGCCACTGG + Intergenic