ID: 1077832567

View in Genome Browser
Species Human (GRCh38)
Location 11:5890499-5890521
Sequence ATGGACCTAGAGAGGCCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077832567 Original CRISPR ATGGACCTAGAGAGGCCGAA AGG Intronic