ID: 1077836269

View in Genome Browser
Species Human (GRCh38)
Location 11:5930346-5930368
Sequence CCGGATCTAGGCGGGTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077836269_1077836274 -10 Left 1077836269 11:5930346-5930368 CCACTATACCCGCCTAGATCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1077836274 11:5930359-5930381 CTAGATCCGGCCTCCCCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 76
1077836269_1077836275 -9 Left 1077836269 11:5930346-5930368 CCACTATACCCGCCTAGATCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1077836275 11:5930360-5930382 TAGATCCGGCCTCCCCTGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1077836269_1077836276 -8 Left 1077836269 11:5930346-5930368 CCACTATACCCGCCTAGATCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1077836276 11:5930361-5930383 AGATCCGGCCTCCCCTGCAGGGG 0: 1
1: 0
2: 1
3: 9
4: 142
1077836269_1077836281 4 Left 1077836269 11:5930346-5930368 CCACTATACCCGCCTAGATCCGG 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1077836281 11:5930373-5930395 CCCTGCAGGGGCAACCATCTTGG 0: 1
1: 0
2: 1
3: 14
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077836269 Original CRISPR CCGGATCTAGGCGGGTATAG TGG (reversed) Intronic
1067067299 10:43111190-43111212 CCCGATCTAGGGGGGCACAGGGG - Exonic
1076746060 10:132515124-132515146 CCGAATCCAGGCAGGGATAGTGG - Intergenic
1077836269 11:5930346-5930368 CCGGATCTAGGCGGGTATAGTGG - Intronic
1077996534 11:7457204-7457226 CTGGATCTAGGCAGGAAAAGAGG - Intronic
1094718308 12:33034711-33034733 CCAGCTCTAGGCTGGTATTGGGG + Intergenic
1096094561 12:48925618-48925640 CCGGATCTTGGAGGGTACAGAGG - Exonic
1101341196 12:103842475-103842497 CCGATTCTCGGCAGGTATAGAGG - Intronic
1108519677 13:51235015-51235037 CCGGATCTGGACGGGGACAGAGG - Intronic
1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG + Intronic
1123485292 15:20730398-20730420 GCAGATCTAGGCGGGTATGGAGG - Intergenic
1123541780 15:21299447-21299469 GCAGATCTAGGCGGGTATGGAGG - Intergenic
1202950095 15_KI270727v1_random:26589-26611 GCAGATCTAGGCGGGTATGGAGG - Intergenic
1136375631 16:29863562-29863584 CAGGCTCTAGGCGGCTAGAGAGG + Exonic
1150343324 17:64386044-64386066 CCTGAGCTAGGCGGGTGCAGTGG + Intronic
929252669 2:39776676-39776698 CCGAATCCAGCCTGGTATAGTGG - Intronic
934539007 2:95159446-95159468 CCGGAGCTAGGCAGGGACAGCGG - Exonic
934980249 2:98833569-98833591 CAGGATCTAGGCAGGCACAGAGG - Intronic
940443889 2:153753812-153753834 CAGGACCTAGGCAGGTTTAGAGG + Intergenic
944873985 2:203943456-203943478 CCGGCTCTGGGCTGGTATTGGGG + Intronic
954391699 3:50271016-50271038 CCGGATCTAGGCAGGGAGGGAGG + Intronic
962163484 3:133024103-133024125 CAGGAGGTAGGCTGGTATAGTGG - Intergenic
985092971 4:186382305-186382327 CCGGCTCTAGGCTGGTACTGGGG - Intergenic
993795991 5:92268259-92268281 CAGAATCTTGGCGGGCATAGAGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1003731724 6:8832147-8832169 CCGGAGCAGGGCGGGTATATGGG - Intergenic
1006866919 6:37216229-37216251 CCAAAATTAGGCGGGTATAGTGG - Intronic
1008059892 6:46985686-46985708 CCGGGACTGGGAGGGTATAGTGG + Intergenic
1047257712 8:123228216-123228238 CCTGACCTAGGCTGGTACAGTGG - Intronic
1194765511 X:97843228-97843250 TGGGATCAAGGCGGGTATACTGG - Intergenic