ID: 1077837510

View in Genome Browser
Species Human (GRCh38)
Location 11:5937628-5937650
Sequence ACCAGGGCGGAGAGGGTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 2, 1: 2, 2: 1, 3: 8, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077837510_1077837519 2 Left 1077837510 11:5937628-5937650 CCTACGACCCTCTCCGCCCTGGT 0: 2
1: 2
2: 1
3: 8
4: 99
Right 1077837519 11:5937653-5937675 TTCCTGGTGGTTTTCACCCGTGG 0: 1
1: 0
2: 4
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077837510 Original CRISPR ACCAGGGCGGAGAGGGTCGT AGG (reversed) Intronic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
903854442 1:26328474-26328496 CCCAGGGCGGAGAGGGAGGCTGG + Intronic
904463647 1:30695030-30695052 ACCTGGGAGGAGGGGGTGGTGGG + Intergenic
905343215 1:37293365-37293387 ACTGGGGAGGAGAGGGTGGTGGG - Intergenic
910509759 1:87990651-87990673 ACCAGTGGGGAGAAGGTCATGGG - Intergenic
913654818 1:120950489-120950511 ACCCGGGAGGAGAAGGTTGTAGG + Intergenic
914645015 1:149644631-149644653 ACCCGGGAGGAGAAGGTTGTAGG + Intergenic
915322414 1:155063047-155063069 GCCAGGGCGGAGCGGGGCGGCGG + Intergenic
919640194 1:200039083-200039105 ACCAGGCAGGAGAGGGAGGTTGG + Intronic
921279218 1:213549246-213549268 ACCAGGGCCAAGAGAGTCTTAGG + Intergenic
1070130624 10:73653227-73653249 ACCAGGTCGGAGGGGGCCATGGG + Exonic
1075521314 10:123145266-123145288 ACCAGGGAAGAGATGGTGGTGGG - Intergenic
1075578719 10:123599717-123599739 GCCAGGGCTGAGAGAGTTGTGGG + Intergenic
1076507609 10:130988131-130988153 TCCAGGGCCGGGAGGGTGGTAGG - Intergenic
1077837510 11:5937628-5937650 ACCAGGGCGGAGAGGGTCGTAGG - Intronic
1081782002 11:45719553-45719575 AACAGGCCTGAGAGGGTCATGGG - Intergenic
1082787254 11:57324058-57324080 ACCAGGGGGTAGAGGGTAGCAGG + Intronic
1084714653 11:70865977-70865999 ACCAGGGAGGAGAGGGCCCAGGG - Intronic
1089221858 11:116878681-116878703 ACCAGGTCAGAGAGGGAAGTAGG - Intronic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1096656553 12:53096217-53096239 GGCAGGGAGGAGAGGGTTGTGGG - Intergenic
1102207080 12:111098077-111098099 ACCATGGAGAGGAGGGTCGTAGG + Intronic
1102957147 12:117066137-117066159 CCTAGGGAGGAGAGGGTCCTTGG - Intronic
1105475936 13:20728247-20728269 CCCAGGGAGGAGAGATTCGTGGG - Intergenic
1114267736 14:21082558-21082580 ACATGGGAGGAGAGGGCCGTGGG - Intronic
1115426826 14:33270158-33270180 ACTAGGAAGGAGAGGGTGGTAGG - Intronic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1117730264 14:58715115-58715137 ACCAGGCCAGGGAGGGTCTTGGG - Intergenic
1122082289 14:99274301-99274323 CCCAGGAAGGTGAGGGTCGTGGG - Intergenic
1122329911 14:100904959-100904981 ACCAGGGGGTAGAGGGAGGTGGG + Intergenic
1123012927 14:105357938-105357960 GCCAGGGCTGAGAGTGTGGTGGG + Intronic
1124248879 15:28094857-28094879 CCCAGGGCGGAGTGGGGCGACGG + Intronic
1128752172 15:70157621-70157643 AACAGGGCAGAGAGGCTAGTTGG - Intergenic
1129235998 15:74224133-74224155 ACCATGGCGGAGAGAGAGGTGGG + Intergenic
1139593866 16:67947287-67947309 GCCAGGGCGCAGAGGTTCTTAGG - Intronic
1142319180 16:89370165-89370187 TCCAGGGCAGGGAGGGGCGTGGG - Intronic
1144670478 17:17129993-17130015 ACCAGGGAGGAGAGGGGCTCAGG + Intronic
1145935325 17:28711654-28711676 ACCTGGGCGGAGAGCGATGTGGG - Exonic
1148216606 17:45836870-45836892 ACCAGGGAGGAGAGCCCCGTGGG + Intergenic
1149642169 17:58210098-58210120 ACCAGGGAGGAGAGGTTTGAGGG + Intronic
1151813109 17:76456695-76456717 AACAGGGCTGAAAGGGTCATGGG - Intronic
1152846866 17:82606044-82606066 TCCTGGGCAGAGACGGTCGTGGG + Intronic
1160087024 18:75786135-75786157 ACCAGGTCTGGGAGGGTTGTAGG + Intergenic
1161153418 19:2721008-2721030 ACCAATGCGGAGAGGGGCGGCGG + Intronic
1161250879 19:3279593-3279615 ACCAGGGAGGAGCTGGTCGAAGG + Intronic
1163699057 19:18778041-18778063 GACAGGGCGAGGAGGGTCGTGGG - Exonic
1166768133 19:45264755-45264777 GGCAGGGCGGAGAGGGTGGGCGG - Intronic
1167104688 19:47423405-47423427 ACCAGGGAGGAGAGCGAGGTGGG - Intergenic
1167413476 19:49358510-49358532 ATCATGGCGGAGGGGGTAGTGGG - Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
927209343 2:20629285-20629307 ACCAGGGAGGAGAGGATTGAGGG - Intronic
927679939 2:25132591-25132613 ACCAGGGCGGAGCGGGGGGTCGG - Intronic
929051191 2:37838355-37838377 ACCAGGGAGGAGAGGATAGCTGG + Intergenic
931257379 2:60585190-60585212 AGCAAGGCAGAGTGGGTCGTGGG + Intergenic
933559671 2:83874687-83874709 ACCAGGGCGGAGAGGGTCGTAGG + Intergenic
942292497 2:174486749-174486771 GCCAGGGCGCAGAGGGTCGGCGG + Intronic
946708742 2:222485441-222485463 AGCAGGGCGGAGAAGGGCTTTGG + Intronic
948699610 2:239751560-239751582 GCCAGGGAGGAGGGGGCCGTTGG + Intergenic
1173323606 20:42011951-42011973 ACCAGGAAGGAGAGGGTCTATGG - Intergenic
1174542227 20:51298575-51298597 ACCAGGGCGGAGAGAGATCTTGG + Intergenic
1174776173 20:53345205-53345227 AGCAGGGCAGAGAGGCTGGTTGG + Intronic
1175547879 20:59791019-59791041 ACCAGGGAGGTGAGGGTAGAAGG + Intronic
1176219083 20:63961556-63961578 ACCAGGGCGGCAGGGGTGGTAGG + Intronic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1182551415 22:31102784-31102806 ACCAGGTTGGAGAGGGCGGTCGG + Intronic
1183306222 22:37084570-37084592 GCCAGGGTGGAGAGGGCTGTGGG - Intronic
1184430301 22:44438407-44438429 ACCAGGGTTGAGAGGCTGGTCGG + Intergenic
1185380292 22:50504770-50504792 CCCAGGGCGGGCAGGGTGGTGGG - Intronic
950577050 3:13838225-13838247 CCCAGGGCCCAGAGGGACGTGGG + Intronic
969058531 4:4416755-4416777 ACCAGAGCAGAGAGGGGCCTTGG - Intronic
973861099 4:55065861-55065883 GCCAGGGCAGAGAGAGTGGTGGG - Intergenic
975721103 4:77249507-77249529 ACCAGGGGGTAGAGGGTATTTGG - Intronic
983926678 4:173410176-173410198 ACCAGAGCGTAGAGGTTTGTGGG + Intergenic
984144867 4:176047822-176047844 ATCAGGGAGGAGAGGGTCAATGG + Intergenic
985000049 4:185473426-185473448 ACCAGGGCGCAGGGGGTTGGGGG + Intergenic
986196965 5:5546218-5546240 ACCAGGGAGGAGAGGGCTGGTGG - Intergenic
987072861 5:14354160-14354182 AGCAGGGCTGGGAGGGTGGTTGG + Intronic
988547723 5:32174054-32174076 AGCCGGGCCGAGAGGGTCGCAGG + Exonic
1001740949 5:174052268-174052290 TTCAGGGAGGAGAGGGTAGTGGG + Intronic
1002495804 5:179610594-179610616 ACCAGGGCTGACCAGGTCGTGGG - Intergenic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1005841534 6:29747684-29747706 CCCAAGGCGGAGAGGGGCGGAGG + Intergenic
1006027454 6:31156726-31156748 GCCAGGGCGGAGAGGCAGGTAGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006580208 6:35072723-35072745 GCCAGGAGGGAGAGGGTCCTGGG + Intronic
1018070909 6:160163669-160163691 ACAATGGCGGAGATAGTCGTGGG - Intergenic
1018802671 6:167236034-167236056 CCCAGGGCAGAGTGGATCGTGGG + Intergenic
1019178885 6:170175283-170175305 ACCTGGGCTGAGGGGGTCCTGGG + Intergenic
1019477989 7:1253118-1253140 ACCAGGGAGGAGGGGTTCGAAGG - Intergenic
1024586768 7:50849139-50849161 AACAAGGCGAAGAGGGTTGTAGG - Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1030866042 7:114702856-114702878 ACCAGGGCGGAGAGGTTGTTGGG + Intergenic
1032279164 7:130486931-130486953 ACCAGGGCGGAGAGCGGCAGTGG + Intronic
1049062068 8:140284180-140284202 ACGAGGACAGTGAGGGTCGTGGG - Intronic
1049204894 8:141359111-141359133 AGCAGGGTGGGGAGGCTCGTGGG + Intronic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1051419008 9:16871591-16871613 AGCTGGGCTGAGAGGGTCGCGGG - Intergenic
1055905934 9:81293055-81293077 AGCGGGGCGGGGAGGGTGGTTGG + Intergenic
1059102230 9:111482975-111482997 GGGAGGGCGGAGAGGGTCGCCGG - Intronic
1059454451 9:114390718-114390740 GCAAGGGCAGAGAGGGTGGTGGG - Intronic
1060063927 9:120486110-120486132 ACCAGGGCAGCTAGGGTGGTTGG - Intronic
1060973630 9:127752958-127752980 ACCAGGGTGGAGAGGGCAGGTGG + Intronic
1060976527 9:127768221-127768243 TGCAGGGCCGAGAGGGTCGTGGG + Intronic
1061769192 9:132904703-132904725 TCCAGAGCGGAGAGGGTTGCAGG + Intronic
1062108380 9:134768047-134768069 ACCAGGGAGGACAGGGTGGTGGG + Intronic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1200244567 X:154516163-154516185 CCCGGGGCGGAGCGGGTCGGCGG - Exonic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic