ID: 1077841746

View in Genome Browser
Species Human (GRCh38)
Location 11:5982846-5982868
Sequence GGGGAAGGAGTGAATTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841746_1077841754 9 Left 1077841746 11:5982846-5982868 CCTATTTAATTCACTCCTTCCCC No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data
1077841746_1077841757 30 Left 1077841746 11:5982846-5982868 CCTATTTAATTCACTCCTTCCCC No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841746_1077841749 -8 Left 1077841746 11:5982846-5982868 CCTATTTAATTCACTCCTTCCCC No data
Right 1077841749 11:5982861-5982883 CCTTCCCCAGGAGCCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841746 Original CRISPR GGGGAAGGAGTGAATTAAAT AGG (reversed) Intergenic
No off target data available for this crispr