ID: 1077841750

View in Genome Browser
Species Human (GRCh38)
Location 11:5982865-5982887
Sequence CTGGCCTTGAGTGGCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841750_1077841757 11 Left 1077841750 11:5982865-5982887 CCCCAGGAGCCACTCAAGGCCAG No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841750_1077841754 -10 Left 1077841750 11:5982865-5982887 CCCCAGGAGCCACTCAAGGCCAG No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841750 Original CRISPR CTGGCCTTGAGTGGCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr