ID: 1077841751

View in Genome Browser
Species Human (GRCh38)
Location 11:5982866-5982888
Sequence TCTGGCCTTGAGTGGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841751_1077841757 10 Left 1077841751 11:5982866-5982888 CCCAGGAGCCACTCAAGGCCAGA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841751 Original CRISPR TCTGGCCTTGAGTGGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr