ID: 1077841752

View in Genome Browser
Species Human (GRCh38)
Location 11:5982867-5982889
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841752_1077841757 9 Left 1077841752 11:5982867-5982889 CCAGGAGCCACTCAAGGCCAGAA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841752 Original CRISPR TTCTGGCCTTGAGTGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr