ID: 1077841754

View in Genome Browser
Species Human (GRCh38)
Location 11:5982878-5982900
Sequence TCAAGGCCAGAAATGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841746_1077841754 9 Left 1077841746 11:5982846-5982868 CCTATTTAATTCACTCCTTCCCC No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data
1077841748_1077841754 -6 Left 1077841748 11:5982861-5982883 CCTTCCCCAGGAGCCACTCAAGG No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data
1077841745_1077841754 19 Left 1077841745 11:5982836-5982858 CCACACATTGCCTATTTAATTCA No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data
1077841750_1077841754 -10 Left 1077841750 11:5982865-5982887 CCCCAGGAGCCACTCAAGGCCAG No data
Right 1077841754 11:5982878-5982900 TCAAGGCCAGAAATGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841754 Original CRISPR TCAAGGCCAGAAATGAGACC TGG Intergenic
No off target data available for this crispr