ID: 1077841755

View in Genome Browser
Species Human (GRCh38)
Location 11:5982884-5982906
Sequence TGAGCACCAGGTCTCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841755_1077841757 -8 Left 1077841755 11:5982884-5982906 CCAGAAATGAGACCTGGTGCTCA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841755 Original CRISPR TGAGCACCAGGTCTCATTTC TGG (reversed) Intergenic
No off target data available for this crispr