ID: 1077841757

View in Genome Browser
Species Human (GRCh38)
Location 11:5982899-5982921
Sequence GGTGCTCAGCAACCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077841753_1077841757 2 Left 1077841753 11:5982874-5982896 CCACTCAAGGCCAGAAATGAGAC No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841748_1077841757 15 Left 1077841748 11:5982861-5982883 CCTTCCCCAGGAGCCACTCAAGG No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841751_1077841757 10 Left 1077841751 11:5982866-5982888 CCCAGGAGCCACTCAAGGCCAGA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841755_1077841757 -8 Left 1077841755 11:5982884-5982906 CCAGAAATGAGACCTGGTGCTCA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841752_1077841757 9 Left 1077841752 11:5982867-5982889 CCAGGAGCCACTCAAGGCCAGAA No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841746_1077841757 30 Left 1077841746 11:5982846-5982868 CCTATTTAATTCACTCCTTCCCC No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data
1077841750_1077841757 11 Left 1077841750 11:5982865-5982887 CCCCAGGAGCCACTCAAGGCCAG No data
Right 1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077841757 Original CRISPR GGTGCTCAGCAACCCCATGC AGG Intergenic
No off target data available for this crispr