ID: 1077843436

View in Genome Browser
Species Human (GRCh38)
Location 11:5999279-5999301
Sequence CCTATTATTCAGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077843427_1077843436 19 Left 1077843427 11:5999237-5999259 CCTTAATGCCCCAAGGTAAATAA No data
Right 1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG No data
1077843430_1077843436 10 Left 1077843430 11:5999246-5999268 CCCAAGGTAAATAAGGTGTGCAA No data
Right 1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG No data
1077843425_1077843436 28 Left 1077843425 11:5999228-5999250 CCATGGATACCTTAATGCCCCAA No data
Right 1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG No data
1077843431_1077843436 9 Left 1077843431 11:5999247-5999269 CCAAGGTAAATAAGGTGTGCAAT No data
Right 1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG No data
1077843429_1077843436 11 Left 1077843429 11:5999245-5999267 CCCCAAGGTAAATAAGGTGTGCA No data
Right 1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077843436 Original CRISPR CCTATTATTCAGAGGGCAGC AGG Intergenic
No off target data available for this crispr