ID: 1077846521

View in Genome Browser
Species Human (GRCh38)
Location 11:6031047-6031069
Sequence GCTAAGTTGTTAGCAGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077846521_1077846522 1 Left 1077846521 11:6031047-6031069 CCTAAAGCTGCTAACAACTTAGC No data
Right 1077846522 11:6031071-6031093 GAGTTTTATTTCAATAGATGTGG No data
1077846521_1077846523 4 Left 1077846521 11:6031047-6031069 CCTAAAGCTGCTAACAACTTAGC No data
Right 1077846523 11:6031074-6031096 TTTTATTTCAATAGATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077846521 Original CRISPR GCTAAGTTGTTAGCAGCTTT AGG (reversed) Intergenic
No off target data available for this crispr