ID: 1077846523

View in Genome Browser
Species Human (GRCh38)
Location 11:6031074-6031096
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077846521_1077846523 4 Left 1077846521 11:6031047-6031069 CCTAAAGCTGCTAACAACTTAGC No data
Right 1077846523 11:6031074-6031096 TTTTATTTCAATAGATGTGGAGG No data
1077846519_1077846523 27 Left 1077846519 11:6031024-6031046 CCCTAGAGGAAAAGAGAAGCTTT No data
Right 1077846523 11:6031074-6031096 TTTTATTTCAATAGATGTGGAGG No data
1077846520_1077846523 26 Left 1077846520 11:6031025-6031047 CCTAGAGGAAAAGAGAAGCTTTC No data
Right 1077846523 11:6031074-6031096 TTTTATTTCAATAGATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077846523 Original CRISPR TTTTATTTCAATAGATGTGG AGG Intergenic
No off target data available for this crispr