ID: 1077847300

View in Genome Browser
Species Human (GRCh38)
Location 11:6039524-6039546
Sequence CAGAACCAGGAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077847300_1077847310 19 Left 1077847300 11:6039524-6039546 CCTCCTTCCTTCTCCTGGTTCTG No data
Right 1077847310 11:6039566-6039588 CTGTCTGTAGCCCCATGGTGGGG No data
1077847300_1077847305 -9 Left 1077847300 11:6039524-6039546 CCTCCTTCCTTCTCCTGGTTCTG No data
Right 1077847305 11:6039538-6039560 CTGGTTCTGTAGCGCCATGGTGG No data
1077847300_1077847307 14 Left 1077847300 11:6039524-6039546 CCTCCTTCCTTCTCCTGGTTCTG No data
Right 1077847307 11:6039561-6039583 CGTATCTGTCTGTAGCCCCATGG No data
1077847300_1077847308 17 Left 1077847300 11:6039524-6039546 CCTCCTTCCTTCTCCTGGTTCTG No data
Right 1077847308 11:6039564-6039586 ATCTGTCTGTAGCCCCATGGTGG 0: 2
1: 6
2: 19
3: 34
4: 143
1077847300_1077847309 18 Left 1077847300 11:6039524-6039546 CCTCCTTCCTTCTCCTGGTTCTG No data
Right 1077847309 11:6039565-6039587 TCTGTCTGTAGCCCCATGGTGGG 0: 9
1: 15
2: 28
3: 54
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077847300 Original CRISPR CAGAACCAGGAGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr