ID: 1077848491

View in Genome Browser
Species Human (GRCh38)
Location 11:6051124-6051146
Sequence CTAAGAGGAGGGCCCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077848491_1077848498 8 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848498 11:6051155-6051177 AAGGGGCTACTGAGTGCCTGTGG No data
1077848491_1077848500 21 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848500 11:6051168-6051190 GTGCCTGTGGTTGAGATGCAGGG No data
1077848491_1077848499 20 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848499 11:6051167-6051189 AGTGCCTGTGGTTGAGATGCAGG No data
1077848491_1077848496 -9 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848496 11:6051138-6051160 TCCTCTTAGCTTATATTAAGGGG No data
1077848491_1077848502 27 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848502 11:6051174-6051196 GTGGTTGAGATGCAGGGAACAGG No data
1077848491_1077848495 -10 Left 1077848491 11:6051124-6051146 CCTTGCAGGGGCCCTCCTCTTAG No data
Right 1077848495 11:6051137-6051159 CTCCTCTTAGCTTATATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077848491 Original CRISPR CTAAGAGGAGGGCCCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr