ID: 1077853628

View in Genome Browser
Species Human (GRCh38)
Location 11:6099861-6099883
Sequence CTGTGGATACAGAGCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077853619_1077853628 22 Left 1077853619 11:6099816-6099838 CCTGGCCAAATCCAACAATAAAC No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853622_1077853628 11 Left 1077853622 11:6099827-6099849 CCAACAATAAACCAGAGGCCGTA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853617_1077853628 24 Left 1077853617 11:6099814-6099836 CCCCTGGCCAAATCCAACAATAA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853615_1077853628 28 Left 1077853615 11:6099810-6099832 CCTCCCCCTGGCCAAATCCAACA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853616_1077853628 25 Left 1077853616 11:6099813-6099835 CCCCCTGGCCAAATCCAACAATA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853620_1077853628 17 Left 1077853620 11:6099821-6099843 CCAAATCCAACAATAAACCAGAG No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853623_1077853628 0 Left 1077853623 11:6099838-6099860 CCAGAGGCCGTAGATTTTAAACT No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853618_1077853628 23 Left 1077853618 11:6099815-6099837 CCCTGGCCAAATCCAACAATAAA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data
1077853625_1077853628 -7 Left 1077853625 11:6099845-6099867 CCGTAGATTTTAAACTCTGTGGA No data
Right 1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077853628 Original CRISPR CTGTGGATACAGAGCAAGGT GGG Intergenic
No off target data available for this crispr