ID: 1077855905

View in Genome Browser
Species Human (GRCh38)
Location 11:6124611-6124633
Sequence CCCTTTAGCCCTAGTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077855905_1077855912 22 Left 1077855905 11:6124611-6124633 CCCCTGGGACTAGGGCTAAAGGG No data
Right 1077855912 11:6124656-6124678 GCTAACCCCAAAGAGTACCTGGG No data
1077855905_1077855911 21 Left 1077855905 11:6124611-6124633 CCCCTGGGACTAGGGCTAAAGGG No data
Right 1077855911 11:6124655-6124677 AGCTAACCCCAAAGAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077855905 Original CRISPR CCCTTTAGCCCTAGTCCCAG GGG (reversed) Intergenic
No off target data available for this crispr