ID: 1077863089

View in Genome Browser
Species Human (GRCh38)
Location 11:6200158-6200180
Sequence CGGGCTTTTTCTGAATGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077863089_1077863097 23 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863097 11:6200204-6200226 GGAGCCTAAGAGTGGAGGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 302
1077863089_1077863096 18 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863096 11:6200199-6200221 ACAATGGAGCCTAAGAGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 217
1077863089_1077863098 24 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863098 11:6200205-6200227 GAGCCTAAGAGTGGAGGTGAGGG 0: 1
1: 0
2: 1
3: 18
4: 264
1077863089_1077863093 2 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863093 11:6200183-6200205 GTAATGTCCAGTGGTAACAATGG 0: 1
1: 0
2: 1
3: 5
4: 113
1077863089_1077863099 25 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863099 11:6200206-6200228 AGCCTAAGAGTGGAGGTGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 295
1077863089_1077863095 15 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863095 11:6200196-6200218 GTAACAATGGAGCCTAAGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 110
1077863089_1077863090 -7 Left 1077863089 11:6200158-6200180 CCTTCACATTCAGAAAAAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1077863090 11:6200174-6200196 AAGCCCGTTGTAATGTCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077863089 Original CRISPR CGGGCTTTTTCTGAATGTGA AGG (reversed) Exonic
900666513 1:3819063-3819085 TGGAATTTTTCTGAATGTGAAGG - Intronic
902957668 1:19936923-19936945 GGGGCTTGTGCTCAATGTGAGGG - Intergenic
907553049 1:55320250-55320272 CGGGCCTTCAATGAATGTGATGG + Intergenic
908673961 1:66580180-66580202 GGGTCTTTTTCTGAGTGTGATGG - Intronic
911534302 1:99081472-99081494 CAGGCTTTTTGTGAATATAAGGG - Intergenic
912799957 1:112714483-112714505 CGGGCTATTTCTGGGTGTGGAGG + Intronic
915671662 1:157494335-157494357 CGGTCTTTCTCTGAATTTGTTGG + Intergenic
916878094 1:168991942-168991964 CTGGCATTTTCTGTATGTGTAGG - Intergenic
916882499 1:169033375-169033397 AGGGCTTTATTTTAATGTGAGGG + Intergenic
917014844 1:170518376-170518398 CAGACTATTTCTGAATGTGGAGG - Intergenic
1063357977 10:5420023-5420045 TGAGCTTTTTCTGAATGTGTAGG + Intronic
1064690832 10:17917038-17917060 CAGGCTTTTCCTGAGGGTGAGGG + Intergenic
1067048172 10:42997544-42997566 ATGGCTGTTTCTGAAGGTGATGG - Intergenic
1068208621 10:53891241-53891263 CAGAATTTTTCTGAAAGTGAAGG - Intronic
1072756629 10:98025850-98025872 CAGGATAATTCTGAATGTGATGG - Intronic
1073434756 10:103509712-103509734 AGGACTTTTTCTGAAAGTGGAGG + Intronic
1073444167 10:103571061-103571083 CGGGCGGTTGCTGAAGGTGATGG - Exonic
1077334632 11:1997860-1997882 CGGGCTTTTTCTAACTGGGGTGG + Intergenic
1077693258 11:4368775-4368797 CAGGTTTTTCCTGAATGTGAAGG + Intergenic
1077863089 11:6200158-6200180 CGGGCTTTTTCTGAATGTGAAGG - Exonic
1080511951 11:32983611-32983633 TGAGCTCTTTCTGCATGTGAGGG - Intronic
1085625600 11:78069930-78069952 CCTGCTGTTTCTGAATTTGATGG - Exonic
1085725198 11:78949159-78949181 AGGGCATTTTCAGAATGTGGAGG - Intronic
1087796392 11:102458852-102458874 GGAGCTTTGTCTGAATCTGAAGG + Intronic
1089144125 11:116311979-116312001 CAGGCATATTCTGATTGTGACGG + Intergenic
1089949745 11:122514604-122514626 CGAGCTTTATCTGAAGTTGATGG + Intergenic
1090540582 11:127699078-127699100 TAGGCTTTTTTGGAATGTGATGG + Intergenic
1202817615 11_KI270721v1_random:53042-53064 CGGGCTTTTTCTAACTGGGGTGG + Intergenic
1091789216 12:3261834-3261856 TGGGCTTTGTGTGACTGTGAGGG + Intronic
1092137971 12:6162828-6162850 TGGGGTTATTGTGAATGTGAGGG + Intergenic
1094334963 12:29339352-29339374 AAGGCTTTTTCTAAATGGGAGGG - Exonic
1097328256 12:58303829-58303851 GGGTCTTTTTTTGCATGTGACGG + Intergenic
1097393222 12:59040977-59040999 AGAGCTGTTTCTGAATGTGATGG + Intergenic
1103959148 12:124597225-124597247 GGGGCATTTTGTGAATGTGTGGG - Intergenic
1104709964 12:130978895-130978917 CGGGTTGTTTCTGAGTGTGCAGG + Intronic
1105439115 13:20401302-20401324 GGGGCTCTTTCAGAATGTCAAGG + Intergenic
1107055635 13:36100630-36100652 AGGGCCTTTTTTGAATGGGAAGG - Intronic
1107354015 13:39546611-39546633 CTGGCTGTATCTGAATGGGAAGG - Intronic
1110065741 13:71103206-71103228 TGGGCCTTTTCTGGAAGTGAGGG - Intergenic
1111757715 13:92419899-92419921 AGGTCTTTGTCTGAATGGGATGG + Intronic
1111903024 13:94222940-94222962 GGGGCTATCTCTGAATTTGATGG - Intronic
1112755815 13:102632199-102632221 CTGGCTTTTTTTGAATTTTAAGG + Intronic
1116644767 14:47512744-47512766 ATGGCTTTTTCTCACTGTGAGGG + Intronic
1117819548 14:59633281-59633303 CGGGCTTTAGCTTAATGTGTAGG + Intronic
1124445466 15:29727385-29727407 TTGACTTTTTCTGAATGTGATGG - Intronic
1128066869 15:64770634-64770656 CAGGCTTTTTTTGAATATGAGGG - Intronic
1129229376 15:74188397-74188419 CGGGCTTTGTCCCAAGGTGATGG + Intronic
1129619034 15:77126876-77126898 AGGGCTTTTCCTGGATTTGAAGG - Intronic
1131897622 15:97051030-97051052 CGGGGTTTTTCTGAGGGAGAGGG - Intergenic
1132202582 15:99965042-99965064 CACCCTTTTTCTGACTGTGAAGG - Intergenic
1133197093 16:4178743-4178765 AGGGTTTATTCTGAGTGTGAAGG + Intergenic
1134275182 16:12769653-12769675 CGGGCTCATACTGGATGTGAAGG + Intronic
1138629667 16:58283097-58283119 AGGGCTTTTGCTGAATGTCAAGG - Exonic
1140943806 16:79748853-79748875 TGGACTTTTTCTAAGTGTGACGG - Intergenic
1141268222 16:82516308-82516330 TGGGCTTTTTCTGTACTTGAGGG + Intergenic
1142688801 17:1592615-1592637 GGGGCTTTTACTTAGTGTGAGGG + Intronic
1144089106 17:11837706-11837728 GGGTTTTATTCTGAATGTGATGG - Intronic
1146518588 17:33508833-33508855 AGGGCTTTTTCTGGAGATGATGG - Intronic
1148721020 17:49753296-49753318 CGGACTTTTTCTGCATATGTGGG + Intronic
1149131502 17:53307044-53307066 CAGGCCTTCTCTGAATGTGGAGG + Intergenic
1151379132 17:73712831-73712853 GGGGGTCTTTCTGAGTGTGAGGG - Intergenic
1155898847 18:31362789-31362811 CAGACTTATTCTGAATGTAATGG + Intergenic
1156117231 18:33800401-33800423 AGGGCTTTTTCTGAAGGAGTAGG - Intergenic
1157540077 18:48495342-48495364 CTGGCTTTTTCTTATTGTTAAGG - Intergenic
1158605950 18:58896313-58896335 AGAGCTTTTTTTGAAGGTGATGG - Intronic
1164742778 19:30589019-30589041 TGGGGTGTTTCTGAATGTGCTGG + Intronic
925091252 2:1157484-1157506 TGGACTTTTTCTAAGTGTGAAGG - Intronic
925634322 2:5927880-5927902 AGGGATTTTTTTGAAGGTGATGG + Intergenic
928052633 2:28015730-28015752 CCTGATTTTTCTGAATGTTATGG + Intronic
928711537 2:34012230-34012252 CTGGCTTTTATGGAATGTGACGG - Intergenic
931698246 2:64888303-64888325 CGGGCTTTATGTGACTGTGGTGG + Intergenic
934748415 2:96775335-96775357 CTGGCTTCTGCTGAATGTTAAGG + Intronic
940863920 2:158798013-158798035 TGGGGTTCTTCTGAAAGTGAGGG - Intronic
942771981 2:179532479-179532501 CAGCCTTTTTGTGAATGTTACGG - Intronic
943419576 2:187653998-187654020 CAGGCTTTTTCTAATTATGAGGG + Intergenic
943964653 2:194318578-194318600 AGGGCTTTTTCTTAATGAGTGGG - Intergenic
945178227 2:207064922-207064944 CGGGGTGTTTCTGGATCTGAAGG - Intergenic
946970842 2:225089344-225089366 AGATATTTTTCTGAATGTGAAGG + Intergenic
1175687033 20:61038990-61039012 GGGGCACTTTCTGAATGTGGAGG + Intergenic
1178585041 21:33864657-33864679 CTGGCTTTTGCTGAATCTCATGG + Intronic
1178626830 21:34225412-34225434 AGGTCATTTGCTGAATGTGAAGG + Intergenic
949894387 3:8758404-8758426 CGGGCCTTTTGTGAAGTTGATGG - Intronic
950020660 3:9785320-9785342 AGGGCTTGTTCTGATTGCGAGGG + Exonic
951647887 3:24913958-24913980 CTGGCTTTTTCTCTATGCGATGG + Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
954376553 3:50196893-50196915 TGGGCTTTCTCAGAAGGTGATGG + Intergenic
958113655 3:89185045-89185067 CGTGCTTTATCTGCATGTGTGGG + Intronic
960396709 3:117146510-117146532 CGTGCTTTTTCTGAAAGCCAAGG - Intergenic
963392842 3:144690469-144690491 TCGGCTTTTTCTGAATTTTATGG - Intergenic
963768232 3:149361165-149361187 AGGGCTTCTTATGCATGTGAGGG - Intergenic
965609736 3:170531395-170531417 CAGCCTTTTTATGAAAGTGATGG + Intronic
976492704 4:85690437-85690459 AGGGCTTTTTGTGTATGTGTTGG + Intronic
979046962 4:115879359-115879381 AGGGCTTTTTCTAACTCTGAAGG + Intergenic
979986927 4:127326580-127326602 TGGGCATTTTCTGTATATGAGGG - Intergenic
981370742 4:143956144-143956166 CTGGCTTTTTCTGAGTGTCAGGG + Intergenic
981420692 4:144546802-144546824 CTGGCTTTTTCTCATTGTCAGGG + Intergenic
982431159 4:155323704-155323726 AGGGCTATTTCTGAATGAGATGG + Intergenic
984998151 4:185456756-185456778 CTGGATTTTTCTAAATGGGAAGG - Intronic
987556155 5:19453432-19453454 AGGGCTTTTTCTGATTTTGTGGG - Intergenic
989720865 5:44526338-44526360 CTGGCTTTTTCTCAATATTAAGG + Intergenic
990971209 5:61508089-61508111 CGGGCTTCTTTTTCATGTGAGGG + Intronic
994235131 5:97354519-97354541 TGGGCATTTCCTGAATTTGAAGG + Intergenic
996368497 5:122728045-122728067 TTGGCTTTTTCACAATGTGATGG - Intergenic
996413222 5:123181588-123181610 CTGGCTTTTTCTGTTTGAGAAGG + Intronic
997711622 5:136009311-136009333 TGGGCTTCTACTGAGTGTGAAGG + Intergenic
999044637 5:148453720-148453742 CTGGCTTTTACTACATGTGAGGG + Intronic
999201392 5:149819002-149819024 CAGGCTATTTCTGAATCTGTAGG + Intronic
1000395929 5:160774778-160774800 CTGGCTTTGTCTGTTTGTGAAGG + Intronic
1004259592 6:14096459-14096481 TGGGCGCCTTCTGAATGTGAAGG - Intergenic
1004476371 6:15976997-15977019 AGGCCATTTTCTGAATGGGAAGG + Intergenic
1005152062 6:22763085-22763107 TGGGCATTTTCTTCATGTGAGGG + Intergenic
1006086708 6:31600844-31600866 TGGGCTCTTGATGAATGTGAGGG - Intergenic
1007155052 6:39734466-39734488 ACGGCTTTCTCTGAATGTCAGGG - Intergenic
1012126750 6:95439055-95439077 AGGGCTTTTTCTGGATGGTAGGG - Intergenic
1012907570 6:105086001-105086023 TGGGCTATTTCTGAAGGTCAAGG + Intergenic
1013007454 6:106087190-106087212 CAGTTTTTTTCTGAGTGTGAGGG + Intronic
1017230927 6:152072902-152072924 TTGGCTTTCACTGAATGTGAAGG - Intronic
1017987520 6:159456694-159456716 TGGGCTATATCTGGATGTGAAGG - Intergenic
1018391749 6:163346346-163346368 CGGGGTATTTCTGAAGGTGAAGG - Intergenic
1020457484 7:8390497-8390519 AGGGCTTTTTCTGAGGGGGAGGG + Intergenic
1029614101 7:101645442-101645464 CGGGGTGTTTCTGAGTTTGACGG - Intergenic
1031339785 7:120585045-120585067 AGGGCTTTTTCTAACTCTGAAGG + Intronic
1032631384 7:133656478-133656500 AGCGCTTTTTCTGTATTTGAGGG - Intronic
1043382187 8:79714868-79714890 TGGGTTATTTGTGAATGTGAAGG + Intergenic
1046739659 8:117814590-117814612 CGGGCTGTATCTGAATGGAAAGG + Intronic
1049193200 8:141300329-141300351 CGTGCTGTTTCTGAGTGGGATGG + Intronic
1051165779 9:14260830-14260852 CCTGCTTTTTCTGAATTTGAAGG + Intronic
1051206034 9:14690099-14690121 CTGGCTTTTACTGTATCTGAAGG - Intronic
1052883937 9:33625053-33625075 AGGGCTTGTTCTGAATGCGCTGG - Intergenic
1053582647 9:39423078-39423100 CTGGCATTTTCTTTATGTGAAGG + Intergenic
1053846828 9:42247923-42247945 CTGGCATTTTCTTTATGTGAAGG + Intergenic
1054104226 9:60981821-60981843 CTGGCATTTTCTTTATGTGAAGG + Intergenic
1054582118 9:66925029-66925051 CTGGCATTTTCTTTATGTGAAGG - Intronic
1054987592 9:71280469-71280491 TTGGCTTTTTCTGAAGGGGAAGG - Intronic
1055001760 9:71458858-71458880 AGGACTTGTTCTAAATGTGATGG + Intergenic
1061542779 9:131287283-131287305 AGGGCTCTTTCTGTCTGTGATGG - Intergenic
1185711394 X:2306385-2306407 AGAGATTTTTCTGAATGTCAGGG - Intronic
1186988076 X:15037989-15038011 AGGGCTTTTTCTGAAGCTGTGGG + Intergenic
1187223378 X:17352563-17352585 GGGGCTTTTTCTGATTTGGAAGG - Intergenic
1193198421 X:78659880-78659902 CTGGCTCTTTCTGAATGTCCTGG + Intergenic
1194169089 X:90559398-90559420 CAGGCTTTTTCTGATTGGTAGGG + Intergenic
1194867932 X:99091798-99091820 CGGGTCTTTTCAGAAGGTGAAGG + Intergenic
1197339889 X:125254491-125254513 CAGACTTTTTTTGTATGTGAGGG + Intergenic
1197556903 X:127967071-127967093 CAGGCTTTCTCTAACTGTGAAGG - Intergenic
1200515326 Y:4137183-4137205 CAGGCTTTTTCTGATTGGTAGGG + Intergenic
1201688459 Y:16734367-16734389 AAGGCCTTTTCTGCATGTGATGG + Intergenic