ID: 1077864346

View in Genome Browser
Species Human (GRCh38)
Location 11:6210617-6210639
Sequence TCTGGGGCCCCCTCCAGAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864346_1077864353 -3 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864353 11:6210637-6210659 AGATACTGTCAGGTACTACTAGG 0: 1
1: 0
2: 1
3: 7
4: 92
1077864346_1077864358 21 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864358 11:6210661-6210683 GAAATGATGATGAGATGGATGGG 0: 1
1: 0
2: 1
3: 28
4: 387
1077864346_1077864360 25 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864360 11:6210665-6210687 TGATGATGAGATGGATGGGAGGG 0: 1
1: 1
2: 2
3: 44
4: 426
1077864346_1077864354 -2 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864354 11:6210638-6210660 GATACTGTCAGGTACTACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 75
1077864346_1077864359 24 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864359 11:6210664-6210686 ATGATGATGAGATGGATGGGAGG 0: 1
1: 0
2: 4
3: 61
4: 526
1077864346_1077864356 16 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864356 11:6210656-6210678 TAGGGGAAATGATGATGAGATGG 0: 1
1: 0
2: 4
3: 34
4: 378
1077864346_1077864355 -1 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864355 11:6210639-6210661 ATACTGTCAGGTACTACTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 70
1077864346_1077864357 20 Left 1077864346 11:6210617-6210639 CCCCTTCTGGAGGGGGCCCCAGA 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1077864357 11:6210660-6210682 GGAAATGATGATGAGATGGATGG 0: 1
1: 0
2: 2
3: 45
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864346 Original CRISPR TCTGGGGCCCCCTCCAGAAG GGG (reversed) Exonic
900479083 1:2889627-2889649 TCTGGGGGCCCCGCTGGAAGAGG + Intergenic
900911639 1:5600744-5600766 CCTGGTGCCCCCAACAGAAGAGG + Intergenic
901051663 1:6428604-6428626 TCTGGGGGCAGCCCCAGAAGGGG - Intronic
901652725 1:10752341-10752363 TCTAGGGGCCTCTCCAGAGGAGG - Intronic
902482660 1:16719757-16719779 TCTGGGGGCAGCCCCAGAAGGGG + Intergenic
902641337 1:17768224-17768246 TCTGGGGACCCCACCAGGATGGG + Intronic
903515641 1:23909103-23909125 GCTGGGGCCCCATCCAGTCGGGG - Intronic
903834032 1:26191180-26191202 CCTGGGGCCCACTCTAGAGGGGG - Intronic
904092431 1:27954700-27954722 TCTGGAGCCCACTGCAGATGAGG + Intronic
904882589 1:33712103-33712125 TCTGTCGCCCCCATCAGAAGGGG + Intronic
905171548 1:36112800-36112822 TCTGGGGCCCCATCGAGATTCGG + Intronic
905296388 1:36957018-36957040 TCTGTGGCCTGCTCCAGCAGAGG - Intronic
905342465 1:37288623-37288645 TCTGGAGCTCCCTCCTCAAGAGG + Intergenic
907578512 1:55550849-55550871 TCTGGGACCCCACCCAGAACGGG + Intergenic
907802890 1:57789281-57789303 TCTTGGGCCCACGCGAGAAGAGG + Intronic
914782412 1:150797722-150797744 ACTGGGGGCCCCTGGAGAAGGGG - Intronic
914874528 1:151502872-151502894 TCAGGTGACCACTCCAGAAGTGG - Intergenic
915142861 1:153777748-153777770 ACTGTGGCCCCTGCCAGAAGTGG - Exonic
915513604 1:156400519-156400541 TCTAGGGCCCCATCCTGGAGGGG + Intergenic
915721360 1:157988159-157988181 TCTTAGGCCTCCTACAGAAGGGG - Intergenic
916302486 1:163291664-163291686 CCTGTGGCCCCACCCAGAAGTGG + Intronic
918202486 1:182280197-182280219 ACTGGGGCCACATGCAGAAGAGG - Intergenic
920541570 1:206782724-206782746 CCTGGGGCCCCTTGGAGAAGGGG - Intergenic
920772949 1:208906810-208906832 TCTGTGCCCCCATCCAGAGGTGG - Intergenic
922880892 1:228979569-228979591 GCTGGGGCCCCCTCCTGCAGGGG + Intergenic
923387204 1:233476981-233477003 CCTGTGGCCCCACCCAGAAGTGG + Intergenic
1067132184 10:43574647-43574669 TCAGGGGCCCGCGCCGGAAGTGG - Intergenic
1067778023 10:49176997-49177019 TCAGGGGCCCCTTCCAGAGGGGG + Intronic
1069177589 10:65312787-65312809 CCTGTGGCCCCACCCAGAAGGGG + Intergenic
1069814233 10:71183544-71183566 TCAGGGGCCCCTCCCAGATGAGG + Intergenic
1069961243 10:72080659-72080681 TCTGCCGCCCCCTCCAAGAGAGG - Intronic
1072551692 10:96483230-96483252 TCTGATGCCCTCTCCAGATGTGG + Intronic
1074599764 10:114901650-114901672 TCAGGGCCCCCTTCCGGAAGTGG + Intergenic
1075795418 10:125116462-125116484 ACTCTGGCCCCCTTCAGAAGGGG + Intronic
1076335800 10:129705815-129705837 TCCTGGGCCCCGTGCAGAAGGGG - Intronic
1077160030 11:1108443-1108465 CCTGGGGCCTCCTCCAGGTGGGG + Intergenic
1077289254 11:1781337-1781359 GCGGGAGCCACCTCCAGAAGGGG - Intergenic
1077519780 11:3025696-3025718 TCTGGGGACACATCCACAAGAGG - Intronic
1077864346 11:6210617-6210639 TCTGGGGCCCCCTCCAGAAGGGG - Exonic
1078059398 11:8033540-8033562 CCTGAGGGCCCCTTCAGAAGGGG - Intronic
1079873810 11:25832010-25832032 TGGGGGGCACCCCCCAGAAGGGG + Intergenic
1083572843 11:63769217-63769239 TCTGGGGCCCCTGCCAGTAGCGG - Intergenic
1084737701 11:71116495-71116517 CCTGGGCCTCCCTCCAGAAGTGG - Intronic
1084815254 11:71642047-71642069 TCTGGCGGCCCCTCGAAAAGAGG + Intergenic
1087886571 11:103489621-103489643 CCTGTGGCCCCACCCAGAAGTGG - Intergenic
1088114561 11:106300197-106300219 TCTTGGCCCCTTTCCAGAAGAGG + Intergenic
1088135202 11:106548425-106548447 TCTAGGGCCACCTCCAGTATTGG - Intergenic
1088606946 11:111541332-111541354 TCTGCGGCCGCCTCCCGGAGCGG - Intronic
1088836212 11:113579800-113579822 TCAGGTGCCCTGTCCAGAAGGGG + Intergenic
1089195967 11:116694236-116694258 TCTGCTGACCTCTCCAGAAGGGG - Intergenic
1089322803 11:117637951-117637973 TCTGGGGGCCTCTACAGAATGGG - Intronic
1091927806 12:4370196-4370218 TCTGGGGTCCCTTCCACAGGAGG - Exonic
1096223534 12:49848412-49848434 TTTGGGGCCAGATCCAGAAGGGG + Intergenic
1098285861 12:68906278-68906300 TCCTGGGCCCCATCCAGAACAGG + Intronic
1102076735 12:110065967-110065989 TATGGGGTCACCTCCAGAACTGG + Exonic
1104902954 12:132199008-132199030 CCTGAGGGCCCCTCTAGAAGAGG - Intronic
1105269617 13:18859739-18859761 TCTGTGGAGCCCTGCAGAAGTGG - Intergenic
1105368860 13:19785453-19785475 CCTGCAGCCCTCTCCAGAAGTGG + Intergenic
1106460621 13:29964595-29964617 CCTGTGGCCCCATGCAGAAGAGG + Intergenic
1109185763 13:59265750-59265772 TCTGGGGCTTCCACCAGAACTGG + Intergenic
1109711169 13:66162528-66162550 CCTGAGGCCCTCACCAGAAGTGG + Intergenic
1112298704 13:98211170-98211192 TCTGGGGACCCCTCCTTTAGAGG - Intronic
1113504722 13:110807623-110807645 TGTGGAGCCCCCTCCAGATCTGG + Intergenic
1113707369 13:112443535-112443557 TCTGGGTCAGCCCCCAGAAGTGG - Intergenic
1116083230 14:40203339-40203361 ACTGGGTCCCCTTCCAGATGTGG - Intergenic
1116400890 14:44505631-44505653 TATGGAGACCCCTGCAGAAGAGG - Exonic
1119566451 14:75633221-75633243 TCTGGAGCAGCCTCAAGAAGGGG + Intronic
1119691638 14:76677558-76677580 TCCGGAGGCCCCCCCAGAAGTGG + Intergenic
1119716054 14:76860241-76860263 TCTGAGGGCACTTCCAGAAGGGG + Intronic
1122049189 14:99043500-99043522 GCTGTCGGCCCCTCCAGAAGTGG - Intergenic
1122275809 14:100590268-100590290 TCTGGAGTCCCCTGCAGAATCGG + Intergenic
1122293916 14:100694373-100694395 TCTGGAGGAGCCTCCAGAAGAGG - Intergenic
1122632539 14:103113624-103113646 ACTGGGTCCCCCGCTAGAAGGGG - Intergenic
1122861304 14:104583579-104583601 TCTGGAGCCCACACCTGAAGAGG + Intronic
1122917949 14:104867426-104867448 CCTGGGGCTCCCTTCAGCAGGGG - Intronic
1123121623 14:105919442-105919464 TCTGGCGCGGCCTCCAGCAGGGG + Intronic
1123439438 15:20280275-20280297 TCTTGGGCTCCCTCCCAAAGTGG + Intergenic
1124119772 15:26878932-26878954 TCCGTGGCTCTCTCCAGAAGCGG - Intronic
1124225276 15:27888040-27888062 TCTGAGGCCCCCACAGGAAGGGG + Intronic
1125509547 15:40285567-40285589 CCTGGGGGCCACCCCAGAAGGGG - Intronic
1125676309 15:41504187-41504209 GCTGGGGCCCACCCCAGAGGAGG - Exonic
1126181685 15:45791631-45791653 TCTGGGGCCCCATGCAGAGCAGG + Intergenic
1128086208 15:64888468-64888490 TCTGGGGTCAGCTCCAGAAGAGG - Intronic
1128455948 15:67831516-67831538 TCTGGGCCCTCCTCCAGGAGAGG - Intronic
1129777038 15:78243704-78243726 TCTGGGGACCCCTCCAGGTTCGG + Intronic
1131571947 15:93546787-93546809 ACTGGTGCCCCATACAGAAGAGG + Intergenic
1133036586 16:3036939-3036961 CCTGGAGCCGCCTCCGGAAGAGG - Intergenic
1133910053 16:10057396-10057418 TCTGGGGCCTCCACTAGATGAGG + Intronic
1134844765 16:17430551-17430573 ACTGGGGGCCCCTCCAGGAATGG - Intronic
1135056317 16:19234758-19234780 CCTGTGGGCCCATCCAGAAGTGG + Intronic
1135637999 16:24095408-24095430 CCTGTGGCCCCACCCAGAAGTGG - Intronic
1136845728 16:33574123-33574145 TCTTGGGCTCCCTCCCAAAGCGG - Intergenic
1138465488 16:57186716-57186738 TCGGGGGTCCTCACCAGAAGAGG + Exonic
1139830460 16:69793593-69793615 CCTGTGGCCCCACCCAGAAGTGG - Intronic
1203107436 16_KI270728v1_random:1422776-1422798 TCTTGGGCTCCCTCCCAAAGCGG - Intergenic
1142670598 17:1485878-1485900 GCTGGGGTCCCCTCCAGGTGGGG + Intronic
1143337947 17:6187553-6187575 TCAGGTGACCCCTCAAGAAGGGG - Intergenic
1143580776 17:7824397-7824419 TCTGGGGCCCTCTGTAGAAGTGG - Intronic
1143620824 17:8079534-8079556 TCGCGGCTCCCCTCCAGAAGGGG - Exonic
1143647369 17:8239592-8239614 TCTGGAACCCTCTCCAGATGGGG + Intronic
1143715842 17:8768424-8768446 TCTGGAGGTTCCTCCAGAAGAGG + Intergenic
1144836347 17:18158511-18158533 ACTGGGGGACCCTGCAGAAGAGG - Exonic
1144940201 17:18933463-18933485 TCTGGGGCCTCCTCTAGACAGGG - Intergenic
1147238118 17:39072385-39072407 TCTTGGACCCACCCCAGAAGAGG - Intronic
1148758332 17:49986248-49986270 TCTGGGACCCCCTCCAGGGAGGG + Intergenic
1150431824 17:65124413-65124435 TCATGGGCCCACCCCAGAAGTGG - Intergenic
1151576133 17:74953437-74953459 TCTGGGGTCACCTGCAGCAGAGG - Intronic
1151944709 17:77313212-77313234 TCGGGGGCCCCCTCTAGGAATGG + Intronic
1152414058 17:80147498-80147520 TCTGGGGACCCCGCCCGGAGCGG - Intergenic
1154093428 18:11386737-11386759 GCTGGTTCCTCCTCCAGAAGAGG + Intergenic
1154333642 18:13449593-13449615 TCAGGGGCCCTCTCCGGAACAGG - Intronic
1154411880 18:14146074-14146096 TCTGAGTCACCCTCCAGAGGAGG + Intergenic
1154418430 18:14200244-14200266 TCTGTGGAGCCCTGCAGAAGTGG + Intergenic
1155676391 18:28434385-28434407 TCTGTAGCCCCCTCAAGGAGAGG - Intergenic
1161029770 19:2052154-2052176 TCTGGAAACCCCTGCAGAAGAGG - Intergenic
1161108370 19:2455629-2455651 CCTGGGACCCCCTCCATAGGTGG + Intronic
1161195481 19:2983981-2984003 CCTGGGGCCCCCTGCAGTGGGGG - Intronic
1165097926 19:33419875-33419897 GCTGAGGCCCCGCCCAGAAGGGG + Intronic
1165100920 19:33438314-33438336 TCTGGGGCCCCCTGCAGGGCAGG - Intronic
1165392472 19:35546400-35546422 TCTGGGGGCCCATCTGGAAGAGG - Intronic
1165831781 19:38734145-38734167 TCTGGGGCTACCTCCTGGAGTGG - Exonic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167680493 19:50917187-50917209 CCTGGGATCTCCTCCAGAAGTGG + Intergenic
1167910739 19:52699812-52699834 TGTGTGGACTCCTCCAGAAGGGG - Intergenic
1167918393 19:52761082-52761104 TGTGTGGACTCCTCCAGAAGGGG - Intergenic
1168586997 19:57601785-57601807 CCTGAGGCCCTCACCAGAAGTGG - Intronic
925432006 2:3802660-3802682 TCTGGGGTCTCTTCTAGAAGGGG + Intronic
926212124 2:10878877-10878899 TCTGGGTGCCCCTCCAGAGAGGG - Intergenic
927014427 2:18943198-18943220 ACTGCTGCCACCTCCAGAAGTGG + Intergenic
927216891 2:20672447-20672469 CCTGGGGCCCACTCCAGCCGAGG + Exonic
927535102 2:23850101-23850123 TCTGTTGCCCACTCCAGCAGTGG - Intronic
927936191 2:27078277-27078299 TCTGGGGCCCTCTCCCCCAGGGG + Intergenic
931233466 2:60393831-60393853 TCTGGAGCCCCCTCAAGCACCGG + Intergenic
931794996 2:65700484-65700506 TGTGAGGCCCCCTCAAGGAGAGG - Intergenic
932462288 2:71890614-71890636 TCTGGGACCTACACCAGAAGGGG + Intergenic
933817376 2:86079238-86079260 TCTGGGACTCCAGCCAGAAGGGG - Intronic
934498839 2:94836998-94837020 TCTGTGGAGCCCTGCAGAAGTGG - Intergenic
937984702 2:127633249-127633271 TCCGGGGCCCCGTCCTGAGGGGG - Exonic
937997527 2:127706407-127706429 ACTCCGGCCCCCTCGAGAAGGGG + Exonic
938093775 2:128448918-128448940 GCTGGGGCCCCCTCCAGACCAGG - Intergenic
938364514 2:130724212-130724234 CCTGAGGCCCTCACCAGAAGAGG + Intergenic
939985989 2:148830348-148830370 CCTGAGGCCCTCGCCAGAAGCGG + Intergenic
946510036 2:220346196-220346218 TCTGGAGGCCTCCCCAGAAGCGG - Intergenic
946527322 2:220534879-220534901 TCTGTGGCCCCACCCAGATGTGG + Intergenic
948012014 2:234656539-234656561 TCTGTGGCCCCACCCAGAATTGG + Intergenic
948154632 2:235771370-235771392 TCTGGGGCTCCCACCACACGTGG + Intronic
948369020 2:237475581-237475603 TCTGTCGCCCCCTCCCGGAGCGG + Intergenic
1170791564 20:19513175-19513197 TCTGTGACCTCCTCCAAAAGAGG - Intronic
1170818744 20:19738453-19738475 ACTGGTGCCCCTTCAAGAAGAGG + Intergenic
1171823599 20:29876154-29876176 CCTGGGGCCCGCTCAGGAAGGGG - Intergenic
1172249074 20:33466114-33466136 ACTGGGGCCCCACCTAGAAGTGG - Intergenic
1172766405 20:37353467-37353489 TCTGGTCCTCCCTTCAGAAGTGG - Intronic
1172799068 20:37563926-37563948 CCTGTGGCCCCACCCAGAAGCGG + Intergenic
1172992799 20:39048616-39048638 TCAGGTGCTCCCTCCAGAAATGG - Intergenic
1173911603 20:46674831-46674853 TCTGTGGCCCCCTCTAGAATTGG - Intronic
1175345053 20:58266974-58266996 TCAGGGGCCACCTACACAAGTGG + Intergenic
1176420964 21:6514927-6514949 TGGGAGGCACCCTCCAGAAGGGG + Intergenic
1176861152 21:14012258-14012280 TCTGAGTCACCCTCCAGAGGAGG - Intergenic
1177642455 21:23861348-23861370 CCTGAGGCCCTCACCAGAAGTGG + Intergenic
1179648740 21:42792897-42792919 GCTGGGGTCCCATACAGAAGGGG + Intergenic
1179696455 21:43123246-43123268 TGGGAGGCACCCTCCAGAAGGGG + Intergenic
1179954415 21:44730256-44730278 TCTGGGGTCTCCTTCATAAGAGG + Intergenic
1180098396 21:45572427-45572449 TCAGGGCACCCCTCCAGCAGGGG - Intergenic
1180955257 22:19738557-19738579 TCTGGGGTCGCCTCCAGGAGAGG + Intergenic
1180971480 22:19818415-19818437 TCTGAGGCCCCCTGCACCAGTGG + Intronic
1181006236 22:20014985-20015007 TCTGGCACTCCCTCCAGAGGTGG - Intronic
1183649594 22:39146134-39146156 TCTGGGGCCTCATCCTAAAGTGG + Intronic
1184021757 22:41826013-41826035 TCAGGGGCCTCCTGCTGAAGGGG + Exonic
1184022510 22:41830374-41830396 TCAGTGACCCCCTCCAGAGGTGG - Intergenic
1184695937 22:46139190-46139212 TCTTGGGCTCCCTCCCAAAGTGG + Intergenic
1185140905 22:49100734-49100756 TCTGGACACCCCTGCAGAAGGGG + Intergenic
1185155789 22:49192650-49192672 GCTGGGGCCTCCTCCAGGAGAGG - Intergenic
949511452 3:4770554-4770576 AGTGGGGGCCCCTCCAGATGAGG + Intronic
949515174 3:4800974-4800996 TATGTGGCCCTTTCCAGAAGTGG - Intronic
953563892 3:44014732-44014754 TCTGGGGTCCCCTTCAGTTGAGG + Intergenic
954934633 3:54315199-54315221 TCCAGGGCCCCCTCCAGAATGGG + Intronic
957224407 3:77425403-77425425 TCTTTGGCCACCTCCAAAAGAGG - Intronic
960561156 3:119085034-119085056 GTTGAGGCTCCCTCCAGAAGAGG - Intronic
960591853 3:119374376-119374398 CCTGAGGCCCTCACCAGAAGCGG + Intronic
960761442 3:121077228-121077250 TCTGGGGACCCATCCGGGAGTGG - Intronic
961281623 3:125769086-125769108 TCTGGCGGCCCCTCGAAAAGAGG + Intergenic
961491985 3:127262782-127262804 TCATGGGCCCTCTCCAAAAGGGG + Intergenic
961735790 3:129001553-129001575 TCTGGGGCCGCCCCTGGAAGTGG + Intronic
961990985 3:131190568-131190590 CCTGAGGCCCTCACCAGAAGTGG + Intronic
967110062 3:186285115-186285137 TGTTGGGCACCCCCCAGAAGTGG - Intronic
968457200 4:705874-705896 TCTGGGTCCCCCCCAAGAGGAGG - Exonic
968494726 4:909286-909308 TCTAGGGCCTCCTCCAGAGCTGG - Intronic
968665951 4:1822489-1822511 CCTGGGGCCCTCTCCAGAACAGG + Intronic
968731313 4:2270603-2270625 TCTGGGTGCCCCTGCAGCAGCGG + Exonic
969264433 4:6055707-6055729 TCTGGGGACACCTGCAGAAATGG - Intronic
969264603 4:6056322-6056344 TCTGGGGACACCTGCAGAAATGG - Intronic
969346880 4:6575544-6575566 TCTGCACCACCCTCCAGAAGGGG - Intronic
969641127 4:8399387-8399409 TCTGGTGCTCCCGCTAGAAGGGG - Intronic
970194713 4:13542724-13542746 TCTGCCGCCCTCCCCAGAAGAGG - Intronic
974029296 4:56761906-56761928 CCTGTGGCCCCAGCCAGAAGGGG + Intergenic
975717311 4:77217353-77217375 TCTGGGGGACCCTCCATCAGAGG - Intronic
976122034 4:81794034-81794056 CCTGAGGCCCTCACCAGAAGTGG - Intronic
976331186 4:83832793-83832815 TCAGGGGCCTCCTCCAGTAATGG - Intergenic
980206049 4:129720891-129720913 TGGGGGGCACCCTCCAGGAGGGG - Intergenic
984702254 4:182825895-182825917 CCTGGGGCGCCTTCCAGCAGGGG - Intergenic
985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG + Intergenic
988510321 5:31859068-31859090 CCTGTGGCCCCACCCAGAAGTGG + Intronic
988882652 5:35520229-35520251 CCTGGGGCCCCAGCCAGAGGTGG - Intergenic
990178829 5:53137671-53137693 ACTGAGGCCCCCTACAGAAGAGG - Intergenic
990915938 5:60905966-60905988 CCTGTGGCCCCACCCAGAAGTGG - Intronic
997295451 5:132765864-132765886 TCTGGGGCCTCCTCCTGAGTAGG - Intronic
997451357 5:133986220-133986242 TCTGTGGCCTCATCCAGATGTGG + Intronic
998315624 5:141180051-141180073 GCTGGGGCAGCCTCCGGAAGCGG - Exonic
999144148 5:149381588-149381610 TCTGGGGCCCCCACAAGGACTGG - Intronic
1001601124 5:172929229-172929251 TCTGGGCCCCACTCCAGTGGCGG + Intronic
1001889408 5:175326759-175326781 TCTGGGGGCCCCTCCAGCTTGGG - Intergenic
1002899821 6:1401175-1401197 TATGGAGCGTCCTCCAGAAGGGG - Intergenic
1007548313 6:42710243-42710265 ACTGGGGCCCCCTGAAGATGGGG + Intronic
1010104598 6:72151877-72151899 CCTGAGGCCCTCACCAGAAGTGG - Intronic
1011238467 6:85244115-85244137 TCTGGGGCCATTTCCAGAATAGG + Intergenic
1013478428 6:110530846-110530868 CCTGTGGCCCCACCCAGAAGTGG - Intergenic
1014300863 6:119679683-119679705 GTTGGGGCCTCCTCCAAAAGAGG + Intergenic
1016428258 6:143956920-143956942 TCTGGGGCCCCTTCCACCACTGG + Intronic
1017039658 6:150297493-150297515 TCTGTGGCCCCACCCAGAGGTGG + Intergenic
1018764768 6:166924829-166924851 TCTTGGGCCCACTCCAAGAGTGG - Intronic
1018797801 6:167200827-167200849 TCTGGGAAACCCTCCAGGAGGGG + Intergenic
1018961428 6:168452015-168452037 TCTGGGGCTCCCTCCTGTGGTGG - Intronic
1019606254 7:1911725-1911747 TCTGGCGTCACCTCCAGATGAGG + Intronic
1019817078 7:3209220-3209242 CCTGTGGCCCCATCCAGAATTGG - Intergenic
1021075775 7:16302740-16302762 TCAGGGGCCACCTGAAGAAGAGG - Intronic
1023105216 7:36757126-36757148 TCTGGGACACCATGCAGAAGTGG + Intergenic
1023272347 7:38477733-38477755 TTTGGTGCCCCCTCCTCAAGCGG - Intronic
1024239026 7:47419784-47419806 TCTCTGGCCCCACCCAGAAGTGG + Intronic
1024249832 7:47497808-47497830 TATGGGGCTCCCTCCAGGACCGG + Intronic
1024258757 7:47558701-47558723 CCTGGGGCCCCCCTCAGCAGAGG + Intronic
1027218419 7:76198935-76198957 TCTGTGGCCCTATCCAGAAGTGG + Intergenic
1028907971 7:96175999-96176021 TCTGAGGCCCACTACAGATGTGG + Intronic
1032266629 7:130374268-130374290 TCAGGGGCCCCCTCCACAGAAGG - Intergenic
1032401856 7:131629420-131629442 TCTGGGGCCTCCTCCAGCTGCGG + Intergenic
1033755758 7:144397452-144397474 TCTGGGGCATCCCCCAGGAGGGG - Exonic
1036382240 8:8244149-8244171 CCCGCGGCCCCATCCAGAAGTGG + Intergenic
1037593347 8:20332083-20332105 CCAGTGGCCCCCTCCAGCAGTGG + Intergenic
1038327632 8:26584512-26584534 TGTGGGTCCCCCTCCAGACAGGG - Intronic
1038699514 8:29836739-29836761 TCTGTGGCCCCACCCAGAGGTGG + Intergenic
1038869608 8:31479943-31479965 CCTGTGGCCCCACCCAGAAGCGG + Intergenic
1039550932 8:38442404-38442426 TCTGAGCTCCCCTCCAGCAGTGG - Intronic
1039800625 8:40951726-40951748 GGTGGGGACCCCTCCAGAAAGGG - Intergenic
1041009045 8:53523674-53523696 TCTGTTGCCCCCTCCGGATGTGG + Intergenic
1043033300 8:75166785-75166807 TCTGAGGCCCCTTTCATAAGAGG - Intergenic
1044014808 8:87038449-87038471 CCTGTGGCCCCATCCAGAAGAGG - Intronic
1046001516 8:108426048-108426070 TCTGGGGACATCCCCAGAAGAGG - Intronic
1046120379 8:109838956-109838978 TCTGGAGGAACCTCCAGAAGAGG - Intergenic
1047213913 8:122862015-122862037 TCTGGGCCTCCTTCCTGAAGGGG - Intronic
1047422724 8:124720401-124720423 TCTGGGGCAACCACCAAAAGTGG - Intronic
1048867058 8:138769014-138769036 TCTCCAGCCCCCTCCAGAAGTGG + Intronic
1049472616 8:142783128-142783150 CCTCTGGCCCTCTCCAGAAGGGG - Intergenic
1049472897 8:142784178-142784200 CCTCTGGCCCTCTCCAGAAGTGG + Intergenic
1051599029 9:18853457-18853479 CCTGTGGCCCCACCCAGAAGTGG - Intronic
1052313846 9:27096293-27096315 CCTGAGGCCCTCACCAGAAGTGG + Intergenic
1052613762 9:30811877-30811899 TCTGGGGACCCCTGTAGTAGAGG - Intergenic
1052799668 9:32956032-32956054 TCTGGGGCGCCCTCCAGCTGAGG + Intergenic
1053658321 9:40243557-40243579 TCTGTGGAGCCCTGCAGAAGTGG + Intronic
1053908693 9:42872831-42872853 TCTGTGGAGCCCTGCAGAAGTGG + Intergenic
1054359014 9:64094493-64094515 TCTGTGGAGCCCTGCAGAAGTGG + Intergenic
1054370445 9:64389832-64389854 TCTGTGGAGCCCTGCAGAAGTGG + Intronic
1054526277 9:66132664-66132686 TCTGTGGAGCCCTGCAGAAGTGG - Intronic
1054678072 9:67879587-67879609 TCTGTGGAGCCCTGCAGAAGTGG + Intronic
1057555978 9:96087662-96087684 TCTGGGGGCTCCTCCAGCAGGGG + Intergenic
1060520243 9:124290285-124290307 TCTGTGGCCACCTCCTCAAGGGG + Intronic
1062003596 9:134228687-134228709 GCTGGGGCCCCCTCCCCAAAGGG + Intergenic
1203376670 Un_KI270442v1:382670-382692 CCTGGGGCCCGCTCAGGAAGGGG - Intergenic
1185946713 X:4385022-4385044 CCTGTGGCCCCACCCAGAAGGGG + Intergenic
1186702572 X:12107135-12107157 TGTGAGGCACCCTCCAGTAGGGG + Intergenic
1187133740 X:16527109-16527131 TCTGTGGCCCTACCCAGAAGGGG + Intergenic
1187569347 X:20485359-20485381 TCTGGGCTCCCCTCTAGGAGAGG + Intergenic
1189008724 X:37023007-37023029 TCTGGGCGCTCCTTCAGAAGAGG - Intergenic
1189039983 X:37532014-37532036 TCTGGGCGCTCCTTCAGAAGAGG + Intronic
1189147326 X:38668378-38668400 TGTGAAGCCACCTCCAGAAGAGG - Intronic
1189183678 X:39031755-39031777 GCTGGTGCCACCTGCAGAAGTGG + Intergenic
1190778073 X:53570374-53570396 TCTGAAGCCCCCTAAAGAAGTGG + Intronic
1192582453 X:72295915-72295937 TCAGTGGCTCCCTCCAGAACTGG - Intronic
1192583698 X:72304772-72304794 TCTGGGAGCTCCCCCAGAAGAGG + Intronic
1202119813 Y:21510437-21510459 TCTGGGGGCAACTCCAGGAGAGG + Intergenic
1202122264 Y:21533978-21534000 TCTGGGGGCAACTCCAGGAGAGG + Intronic
1202156741 Y:21895405-21895427 TCTGGGGGCAACTCCAGGAGAGG - Intronic
1202159189 Y:21918946-21918968 TCTGGGGGCAACTCCAGGAGAGG - Intergenic
1202185638 Y:22183861-22183883 TCTGGGGGCAACTCCAGGAGAGG - Intergenic
1202205722 Y:22402535-22402557 TCTGGGGGCAACTCCAGGAGAGG + Intronic