ID: 1077864671

View in Genome Browser
Species Human (GRCh38)
Location 11:6212152-6212174
Sequence TTGATTAAGACTGAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864671 Original CRISPR TTGATTAAGACTGAGAAGGA TGG (reversed) Intronic
900562563 1:3314598-3314620 TTCATTGACACAGAGAAGGAGGG - Intronic
902122287 1:14176578-14176600 TTGGCTAAAACAGAGAAGGATGG - Intergenic
902240882 1:15088588-15088610 TCTCTCAAGACTGAGAAGGAGGG + Intronic
904734801 1:32623428-32623450 TTGATTGAGAGTGAGAATGAGGG - Intronic
907530413 1:55090019-55090041 TTGATGAAGATGCAGAAGGAAGG - Intronic
907543300 1:55236570-55236592 TTGAGTAGGACTTCGAAGGAAGG + Intergenic
910061208 1:83094811-83094833 GTTATCAAGACTGAGAAGCAGGG + Intergenic
910575921 1:88763639-88763661 TTCTTTAAGTCTGAGGAGGATGG - Intronic
910824680 1:91393242-91393264 TTGAGCAAGAATGAGAAGAATGG - Intronic
912133841 1:106635421-106635443 TTTATTAAAAGTGAAAAGGAAGG - Intergenic
912156138 1:106922769-106922791 TTTGTTAAGATTGAGGAGGAGGG - Intergenic
914798805 1:150944536-150944558 CTGATAGAGAATGAGAAGGAAGG + Intronic
915084475 1:153375784-153375806 TTGTTTCAGGCTGAGCAGGAGGG - Intergenic
916173347 1:162018581-162018603 TTGATAAAAACTGAGAAGGCTGG - Intronic
916528630 1:165634833-165634855 ATGATCAAGAATGAGAAGGAAGG - Intronic
918117940 1:181512546-181512568 TAGATAAAGTCTTAGAAGGAAGG + Intronic
918212242 1:182361508-182361530 TTGATAAAGACTTAGAACAAAGG - Intergenic
918783910 1:188739150-188739172 TAGATGAATACAGAGAAGGAAGG + Intergenic
919399742 1:197097665-197097687 CTGATTAAGACTGAGGTGGCAGG - Intronic
921660735 1:217798618-217798640 CTGATTAAGACTGAGGATCAAGG - Intronic
923259928 1:232258653-232258675 GGGAGGAAGACTGAGAAGGATGG + Intergenic
923464167 1:234233287-234233309 TTCATTAAAACTGATTAGGATGG + Intronic
924045340 1:240024001-240024023 AAAATTAAGAATGAGAAGGATGG + Intronic
924593667 1:245426989-245427011 TTGATGAAGTCAGAGAAGGATGG + Intronic
1063378380 10:5568411-5568433 TTGTCTAATACTGAGAATGAAGG - Intergenic
1063875244 10:10469677-10469699 TTGCATAAAACAGAGAAGGAAGG - Intergenic
1064780778 10:18835913-18835935 TAGATTTAACCTGAGAAGGAAGG - Intergenic
1066083850 10:31958099-31958121 CTGATTAAGACTGAATAGAATGG - Intergenic
1067678392 10:48407781-48407803 TTGTTTAGAACTGAGAAGGATGG - Intronic
1068049392 10:51930081-51930103 TTCATTCAGCCTTAGAAGGAAGG - Intronic
1068259033 10:54554309-54554331 TTAGTTCAGACTGAGAATGAAGG - Intronic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1071121415 10:82283083-82283105 TAGATTAAGACCGAGAAGACAGG - Intronic
1071399158 10:85252655-85252677 TAGAGTAGGACTGAGAAGGCTGG - Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1071974214 10:90938815-90938837 TTGATATAGACTGAGAACGGAGG - Intergenic
1074548445 10:114420566-114420588 TTGCTTAAGGCTGAGGGGGATGG - Intergenic
1076151874 10:128169032-128169054 TGGATTAAGACTGGGGAGCAGGG + Intergenic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1080045490 11:27803638-27803660 TTGATTTAGATATAGAAGGAAGG + Intergenic
1080997506 11:37621797-37621819 TTGAATAAAACAAAGAAGGAAGG - Intergenic
1081434309 11:43010432-43010454 TTGCTTAAGAGTGAGAAGCACGG - Intergenic
1082954269 11:58851972-58851994 TTGAGAAAGAGTGAGAAGGCTGG + Intronic
1084519015 11:69651439-69651461 TTGCTTAAGTCAGAGATGGAAGG - Exonic
1088921121 11:114260445-114260467 TTGGTAAAGGCTGAGAATGAAGG - Intronic
1089176399 11:116551910-116551932 TTTAATAAGACAGAAAAGGAAGG + Intergenic
1091112185 11:132979814-132979836 TTGTAAGAGACTGAGAAGGAAGG + Intronic
1092596951 12:10017457-10017479 TTGATTAAGAGTGAGTAGAGAGG - Intronic
1093019248 12:14187876-14187898 TGGATTGAGACTGTGAAAGAAGG + Intergenic
1093381867 12:18502732-18502754 TTAATGTTGACTGAGAAGGAAGG + Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093855217 12:24093710-24093732 TTGAATAAGACTGCAATGGACGG + Intergenic
1093974519 12:25406532-25406554 TTGAATAAGAGTGATAAGGTTGG - Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1098040968 12:66353805-66353827 CTGATGACGACTGAAAAGGAGGG - Intronic
1098776242 12:74621866-74621888 TTGATTAACACTAAGAATGTTGG - Intergenic
1099672598 12:85713792-85713814 ATAAATAAAACTGAGAAGGAAGG - Intergenic
1102761194 12:115386880-115386902 TAGACTGAGACTAAGAAGGAAGG + Intergenic
1103463726 12:121125107-121125129 TTGCTTAAGAGTGAGAGGGAAGG - Intergenic
1104654987 12:130567733-130567755 ATGATTAAGACTTAGAGGCAGGG - Intronic
1107688653 13:42929654-42929676 TAGAGAAAGACAGAGAAGGAAGG + Intronic
1108044028 13:46366019-46366041 GTGATTACGACTGAGAAGTCAGG + Intronic
1108539836 13:51430558-51430580 GTGATTAACCCTGAGAAAGAGGG + Intronic
1108887975 13:55212993-55213015 TTGAGTAAGGATGTGAAGGATGG + Intergenic
1109610615 13:64760293-64760315 TGGATGAAGAATGAGAAGCAAGG + Intergenic
1109940489 13:69357784-69357806 TGGCCTAAGATTGAGAAGGAAGG + Intergenic
1110169747 13:72486332-72486354 ATGATTAAGAATGAGCAGGTGGG - Intergenic
1110202151 13:72864228-72864250 TTGCTTGAGAGTGAGGAGGATGG + Intronic
1110957456 13:81573327-81573349 TTCAATATGACTGATAAGGATGG + Intergenic
1112538968 13:100288083-100288105 TTGATTAAGAAAGAGATAGACGG + Intronic
1113415300 13:110124206-110124228 TAGAATAAGACTTAAAAGGATGG + Intergenic
1113678629 13:112226311-112226333 TCAATGAAGACTGAGTAGGAGGG - Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1118264237 14:64279168-64279190 TTGATTCAGCCTGAAAAGGCAGG - Intronic
1119658254 14:76432630-76432652 TTCAGTAAGAGTGAGAGGGAAGG - Intronic
1120755652 14:88241717-88241739 TTGAATTAGACCCAGAAGGATGG - Intronic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1121234788 14:92384302-92384324 TTGATCAAGACTGAAGGGGAGGG + Intronic
1121460732 14:94075471-94075493 TTTATTTAGAGTGAGAAGTATGG - Intronic
1121682761 14:95807954-95807976 TGGATTCAGAGTGAGAGGGAGGG + Intergenic
1124430054 15:29599298-29599320 TTCATTTAGACTAATAAGGATGG + Intergenic
1124801459 15:32837099-32837121 TTGATTAGCACTGAGCTGGAAGG + Intronic
1124807606 15:32901698-32901720 TGGATGAAGAGGGAGAAGGAGGG - Intronic
1124910290 15:33913669-33913691 TTGATTATGACTCAGAGGGCTGG - Intronic
1125399690 15:39287727-39287749 ATGTTTAAGCCTGTGAAGGAGGG - Intergenic
1125492148 15:40156309-40156331 TTGTTTACCACTGAGGAGGAAGG + Intergenic
1125719931 15:41840414-41840436 TGGGTTAAGACTGAGGGGGAGGG - Intronic
1127251715 15:57245569-57245591 TTAATGAACACTGAGTAGGAAGG + Intronic
1128362556 15:66972623-66972645 GAGAGTAAGACTGAGAAGGCCGG + Intergenic
1129734070 15:77949951-77949973 TTGATTTAGACAGATAAGGTGGG + Intergenic
1129841512 15:78746041-78746063 TTGATTTAGACAGATAAGGTGGG - Intergenic
1130379521 15:83359657-83359679 TTCATTTAGACTGGGAAGGAAGG - Intergenic
1130832006 15:87610433-87610455 TTTTTTAAAACTGATAAGGAAGG - Intergenic
1131302396 15:91211002-91211024 TTGATGAAGACAGTGAAGTAAGG + Intronic
1131404382 15:92152297-92152319 TTGCTATAGACGGAGAAGGAAGG - Intronic
1132474782 16:129153-129175 CTGCTGAAGACTCAGAAGGAAGG - Intronic
1135154899 16:20044281-20044303 TTGATTGAGTCTGAGAAATAGGG - Intronic
1135696892 16:24596203-24596225 TTGAATAAGACTGACATTGAAGG - Intergenic
1135722037 16:24826284-24826306 GGGATTAAGACCGAGAAGTAAGG - Intronic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1137738224 16:50741069-50741091 GTGATTAACACTGAGAAAGGAGG - Intergenic
1138055113 16:53824673-53824695 TAAATGAAGACAGAGAAGGAAGG + Intronic
1138423619 16:56916056-56916078 TTGATAAAGGCTGAGAAAAATGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1140651168 16:77090179-77090201 TTAAATAAGACTGATAAAGATGG + Intergenic
1143665996 17:8360983-8361005 GTCATTAGCACTGAGAAGGAAGG - Intergenic
1146697093 17:34917721-34917743 TTGAGAAAGTCTCAGAAGGAAGG + Intergenic
1150937334 17:69651051-69651073 TTGATTGAGACTGTCAAGGTAGG - Intergenic
1152164951 17:78697580-78697602 CTGATTCAGATTGAAAAGGAGGG + Intronic
1153613584 18:6911840-6911862 TTCTTTAAGACTGTGAAGTATGG - Intronic
1153776783 18:8461492-8461514 CAGATGTAGACTGAGAAGGATGG + Intergenic
1157069729 18:44391919-44391941 TAGATTAAAACTAAGAAGAAGGG - Intergenic
1157132385 18:45018903-45018925 CTGATTAGGAATGAGCAGGAAGG + Intronic
1160595497 18:79971030-79971052 TTGCTTAAGACTGGGAGGGAGGG - Exonic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
925087817 2:1124590-1124612 TTCTTTAAGACTGAGTAGGCCGG - Intronic
926022524 2:9509511-9509533 ATGAATAAGACAGACAAGGAAGG + Intronic
926772634 2:16392116-16392138 TTGATATGGACTGAGGAGGATGG + Intergenic
927207063 2:20617400-20617422 TGGGTTAAGACGGAGGAGGAGGG + Intronic
928013919 2:27636290-27636312 TGCATTAAGACTGAGGAGCAAGG + Intronic
928290592 2:30033897-30033919 GTGGCTAACACTGAGAAGGAAGG + Intergenic
928460010 2:31463405-31463427 GGGATTGAGACTCAGAAGGATGG - Intergenic
931465245 2:62480578-62480600 TTGATTAAGGGTGAGATGTAGGG + Intergenic
932733332 2:74235830-74235852 TTGATTCAGAATGGGCAGGAAGG - Intronic
933386790 2:81621039-81621061 TTTATTAATACTGATGAGGAAGG + Intergenic
935250903 2:101259626-101259648 TTTATGAAGTCTAAGAAGGATGG - Intronic
935793415 2:106615267-106615289 TGGATTCAGACTGAGGAGAAGGG + Intergenic
936992153 2:118377565-118377587 GTGATTAAGACAGAGGAAGAGGG - Intergenic
937123059 2:119454041-119454063 AGGACAAAGACTGAGAAGGAAGG + Intronic
937781122 2:125838414-125838436 AAGGTTAAGACTGAAAAGGAGGG - Intergenic
937844607 2:126565809-126565831 TAGAATGAGACTGAGAAGGTTGG + Intergenic
938909541 2:135873954-135873976 GTGATTAAGTCAGAGAAGGTAGG + Intronic
939354165 2:141079601-141079623 TTGATGAAAAGAGAGAAGGAAGG - Intronic
939918414 2:148077707-148077729 TTGATTCAGACTGAGAGGAGTGG + Intronic
940049357 2:149445931-149445953 ATGATTAAGACTGGTGAGGAAGG - Intronic
941172494 2:162156450-162156472 TTGAATAACATTGAGAAGAAGGG - Intergenic
941941717 2:171046052-171046074 ATGATTAAGACCAGGAAGGAAGG - Intronic
942146426 2:173031634-173031656 TTTATTTAGACTGGGAAAGAGGG - Intronic
942303105 2:174581396-174581418 TTGAATAAGACAGAGCAGGCTGG - Exonic
944772171 2:202925595-202925617 TTGCTTCAGGCTGAGAATGAGGG + Intronic
945261863 2:207851184-207851206 TTGATTGAGAATAAGAAGGAAGG - Intronic
945521192 2:210829502-210829524 TTCCAAAAGACTGAGAAGGAAGG - Intergenic
945564469 2:211379834-211379856 TTGTTTAAGCCTGACAGGGAAGG - Exonic
946906739 2:224424618-224424640 TTATTTGAGACTGAGAAGGATGG + Intergenic
948404533 2:237707147-237707169 TAGATTAAAACTGAGAAAGAAGG + Intronic
1168848948 20:963630-963652 TTCATTAAGAATGATAAAGAGGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169395019 20:5221450-5221472 AAGATGAGGACTGAGAAGGAAGG - Intergenic
1169943652 20:10965296-10965318 TTGCCTATGACAGAGAAGGATGG + Intergenic
1170022418 20:11851015-11851037 TTAATTAACTCTGAGAAGCAGGG + Intergenic
1170244027 20:14201248-14201270 TTGATTAAAACTTGGAAGAAAGG + Intronic
1170690730 20:18613003-18613025 TTGATCATGACGGAGAAGGCAGG - Intronic
1170874000 20:20234003-20234025 ATGATGAAGACTGAGGAGGCGGG - Intronic
1172869255 20:38125682-38125704 TTGATGGAGTCGGAGAAGGAGGG - Intronic
1172905605 20:38366915-38366937 TTGACCAAGAGTGAGAAGGCCGG + Intronic
1173595404 20:44255861-44255883 TGGACTGAGACTCAGAAGGAAGG - Intronic
1173780412 20:45751927-45751949 ATGAATAAGACAGAGAAGAAGGG - Intronic
1177329956 21:19645862-19645884 CTGATCATTACTGAGAAGGAAGG + Intergenic
1177843783 21:26264792-26264814 TTGATTAAAACATAGAAGTAAGG - Intergenic
1178220774 21:30657111-30657133 TTACTAGAGACTGAGAAGGAGGG - Intergenic
1178329465 21:31675144-31675166 TTGATGAAAACTAAGAAGAAAGG + Intronic
1178564446 21:33670064-33670086 TTGATTAAAACTGAGAGGCCAGG + Intronic
1178944731 21:36937275-36937297 GAGATTAAGCCTGAGCAGGACGG - Exonic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182724464 22:32432244-32432266 TTGATTAAGAGTGAGGATGGAGG - Intronic
1184179971 22:42814554-42814576 TTGATTAAGCCTTTGAAGAAGGG + Intronic
949986158 3:9542904-9542926 TTGCTTAGGGCTGAGAAGGAAGG + Intronic
950131935 3:10553385-10553407 TTAATTCAGACTGGGAAAGAGGG + Intronic
952180446 3:30911243-30911265 TTGAATAAGAGTGAAATGGAGGG + Intergenic
952479169 3:33743028-33743050 TTGATCAAGACTGTCATGGAAGG + Intergenic
953487656 3:43317523-43317545 TTGATTCAGACTGAAATGGAAGG - Intronic
955721261 3:61883793-61883815 TTGCTTAAGCCTGAGAGGTAGGG - Intronic
955874997 3:63479598-63479620 TTGATTAAGATTGAGGTGGCAGG + Intronic
956595542 3:70962821-70962843 TTCATTAAGATGGAGATGGATGG - Intronic
956972099 3:74537994-74538016 ATGAGCAAGACTTAGAAGGATGG - Intergenic
959614541 3:108332630-108332652 AGGGTTAAGACTGAGAATGATGG - Intronic
959758215 3:109925020-109925042 TAGATTAGGTCTGAGAAGTAGGG - Intergenic
960441347 3:117692797-117692819 GTGATTCAGTCTGAGTAGGAAGG - Intergenic
962484824 3:135832161-135832183 TTGATCAAGACATAGCAGGATGG + Intergenic
962485321 3:135837085-135837107 TTGATTGAGCCTCAGATGGATGG + Intergenic
963417901 3:145022375-145022397 TTGATGATGACAGGGAAGGATGG - Intergenic
964079024 3:152728586-152728608 TTAAATAAGGCTGAGAATGATGG + Intergenic
964913780 3:161814404-161814426 AAGATAAAGACTGAGAAGAATGG - Intergenic
965361945 3:167752375-167752397 TTCATTAAGATGGAGAAGGCTGG - Intronic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
969559393 4:7937785-7937807 TTGATTAAAACTTAGCAGGTCGG - Intronic
972201507 4:36718720-36718742 ATGATTAAAACTGAGAATCACGG - Intergenic
972214616 4:36881565-36881587 TTGTTTTAGACTGAGAAGAGAGG - Intergenic
973041610 4:45476270-45476292 CTGATTTAGACTGTGAAGCAAGG - Intergenic
974057543 4:56998984-56999006 ATGATTAAAACTGAGAAGTCAGG + Intronic
974221885 4:58985585-58985607 TTTAGTAAGACTGAGAAGTTGGG + Intergenic
974239902 4:59233538-59233560 TTGAATAAGAGTGATAAGGGAGG + Intergenic
974970407 4:68818257-68818279 TTGACTAACACTGAAAAAGATGG + Intronic
976059448 4:81109124-81109146 TTGCTTAAGATTCTGAAGGAAGG - Intronic
977163367 4:93664291-93664313 TTGCTTTAGAGTGAGTAGGAAGG + Intronic
978118011 4:105045351-105045373 GTCATTAATACTCAGAAGGAAGG - Intergenic
978649063 4:110978576-110978598 TTGATTAATACTGTCAGGGATGG - Intergenic
980336775 4:131485043-131485065 TTGTTTAAGACTTAAAATGAAGG + Intergenic
982912446 4:161161568-161161590 TTCATTAACACTGAGAAGTGTGG + Intergenic
983591147 4:169412861-169412883 TGGAATAAGACTGAGAGGGGTGG + Intronic
984496781 4:180507810-180507832 ATGGTTGAGAGTGAGAAGGATGG + Intergenic
989812005 5:45688966-45688988 TTGCTTAAGGCTGAGCGGGAGGG + Intronic
990459312 5:56016285-56016307 GTGAATAAGACTTTGAAGGATGG + Intergenic
991252850 5:64583085-64583107 GTGATTAAGACTGAAGAGGTAGG + Intronic
991266196 5:64721058-64721080 TTGATTAAGGATAAGAATGAGGG - Exonic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
992466557 5:77011892-77011914 TTGATCAGGAGAGAGAAGGAAGG - Intergenic
992615902 5:78545903-78545925 TAGCTAAAGACTGAGAAGTAAGG - Intronic
994190353 5:96862274-96862296 TTGATTTAGACTGGGCAGGGTGG - Intronic
994455275 5:99997949-99997971 CTGATTAAGACTGGGATGGTAGG - Intergenic
994476097 5:100272154-100272176 ATGATTAAGACTAATCAGGAAGG + Intergenic
994634893 5:102332587-102332609 TTGAGTTAGAGTGAGAAGAAGGG - Intergenic
994989073 5:106975786-106975808 TTTACTAAGACTGATAAGAAGGG + Intergenic
995053341 5:107731340-107731362 TTGATTAAGGCACAGAAGCAGGG + Intergenic
995081851 5:108060746-108060768 TTGGTTTACACTGAGAAGGGAGG - Intronic
995647168 5:114326168-114326190 TTGATACAGACTGAGGAAGAGGG + Intergenic
995687232 5:114784185-114784207 TTGATTAAAAATGAGAAGAGTGG - Intergenic
996872267 5:128204390-128204412 TTGCTTAGGGCTGGGAAGGATGG - Intergenic
999147636 5:149406592-149406614 GTCATTAAGCCTGAGAAGGGGGG - Intergenic
999413501 5:151374037-151374059 TGGACTAGGCCTGAGAAGGAAGG - Intergenic
999580142 5:153029635-153029657 TTCATGGAGACTGAAAAGGAGGG - Intergenic
1000434734 5:161194377-161194399 TTGTCTAACACTGAAAAGGAAGG + Intergenic
1000505393 5:162110407-162110429 TTGATGTAGACAGAGAAGGTTGG - Intronic
1000657149 5:163893228-163893250 TTGGTTAAGTCTGAAAAGGCAGG - Intergenic
1002988814 6:2218372-2218394 TTGTTTAAAACTTAGAAGGGAGG - Intronic
1004697345 6:18045847-18045869 TTCATTAAGAAAGGGAAGGAAGG - Intergenic
1004940327 6:20549954-20549976 TTAATTAAGATGGAGAAGAATGG - Intronic
1004959499 6:20770713-20770735 TTTATTAAGACTTGGCAGGAAGG - Intronic
1005204702 6:23388704-23388726 TTGATTAATACAGGGAGGGACGG + Intergenic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1007099475 6:39235468-39235490 TTTCTTAAGACTGAGTAGGCCGG - Intergenic
1007326702 6:41067160-41067182 TGGATTATGACTGTGGAGGAGGG - Exonic
1007565180 6:42844575-42844597 GTGATGCACACTGAGAAGGAAGG + Intronic
1008474994 6:51927143-51927165 TTATTTAGGACTGGGAAGGAAGG - Intronic
1010011609 6:71053970-71053992 TTATTTAAGACTTAGAAAGAAGG + Intergenic
1011282328 6:85689437-85689459 TTAGTTAAGATTGGGAAGGAAGG - Intergenic
1012374879 6:98549392-98549414 TTGTTTAAAACTGAGTTGGAGGG - Intergenic
1012403435 6:98865317-98865339 TTGCTAAAGTCTGAGAATGAAGG - Intergenic
1013391419 6:109689956-109689978 TTTATTAAGAACTAGAAGGATGG - Intronic
1015222814 6:130824409-130824431 TTGTTTAAGACATAGGAGGAAGG - Intergenic
1015350612 6:132213812-132213834 TTCCTAAAGACTGAGTAGGAGGG + Intergenic
1015541373 6:134317553-134317575 TTAATGAAGACTGAGCGGGATGG + Exonic
1016026247 6:139290044-139290066 TAGATTAAGACAGGGAATGAGGG + Intronic
1017307643 6:152937749-152937771 TTGATTTGGACTTTGAAGGATGG - Intergenic
1020999563 7:15311639-15311661 TTTATTAAGACATAGAATGATGG - Intronic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1022157132 7:27671821-27671843 TTTATGAAGATGGAGAAGGAGGG + Intergenic
1022461605 7:30613544-30613566 TTGAGAAGGACTGAGAAGTAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022730375 7:33017284-33017306 TATATTAACACTGAGAAGGATGG + Intronic
1022730440 7:33018089-33018111 TATATTAACACTGAGAAGGATGG + Intronic
1024331144 7:48156491-48156513 ATGATAGAGACTGAGAAGGTTGG + Intergenic
1024824177 7:53370172-53370194 TTGATAAAGACAGAGAATGAAGG + Intergenic
1025710898 7:63908162-63908184 TTGTTTAAAATTGAGAAGGAAGG - Intergenic
1025790735 7:64684785-64684807 TAGATAAAGAGTGAGTAGGAAGG - Intronic
1027454195 7:78367307-78367329 ATGATTAGGACAGAGAAGAAAGG + Intronic
1028209432 7:88055200-88055222 TTGGAAAAGACTGAGAGGGAAGG + Intronic
1028344865 7:89767265-89767287 ATGATTAAGAATAATAAGGAAGG + Intergenic
1028612424 7:92726696-92726718 TTGATTAAGACTGGGCATGGTGG - Intronic
1030378357 7:108780996-108781018 ATGATTAATTCTGAGATGGAAGG - Intergenic
1031904221 7:127443089-127443111 TTAAATAAGACTCAGAGGGAAGG - Intergenic
1031980870 7:128123537-128123559 TTAATTAAGACTGCCAGGGATGG + Intergenic
1032072889 7:128820140-128820162 TAGATGAAGACAGGGAAGGAGGG - Intronic
1033265536 7:139883324-139883346 TGGATCAAGACTGGGAAAGAAGG - Intronic
1033658111 7:143386834-143386856 TGGATGATGACTGAGATGGACGG + Intronic
1034192258 7:149221739-149221761 TTGATTGAGACAGAGAGGGAGGG + Intronic
1036792232 8:11728797-11728819 TAGATTAATACTGAGAAGGAAGG - Intronic
1038076218 8:24077901-24077923 TAGTTTTAGACTGAGAAGGTGGG + Intergenic
1038338377 8:26663379-26663401 TGGATTAAGACAGAGCAGGCAGG - Intergenic
1039909301 8:41811539-41811561 TGGATGAAGACTGAGGGGGAAGG - Intronic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1044340306 8:91040006-91040028 TTAATTGTGAATGAGAAGGAAGG - Intronic
1045247834 8:100459011-100459033 TTGAGTAAGACTGTGCAGGCTGG - Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045821254 8:106341292-106341314 TTGAATAAGATTGAGAAAAAAGG + Intronic
1046127727 8:109931203-109931225 TTGAGTAAGAATGAGATGGGAGG + Intergenic
1047081759 8:121470388-121470410 CTGCTTCAGACTGAGAAGGAAGG + Intergenic
1047635763 8:126760334-126760356 ATGATTACCACTGGGAAGGAAGG - Intergenic
1051043145 9:12839923-12839945 TTGATTAACACAGAGAAGACAGG - Intergenic
1051177843 9:14378933-14378955 TTCAGTAACATTGAGAAGGATGG + Intronic
1051806722 9:21002361-21002383 TTGAGGATGACTGATAAGGAGGG - Exonic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1059613884 9:115927888-115927910 TTGGCTATGACTGGGAAGGAAGG + Intergenic
1059858626 9:118431365-118431387 TTGAATAACAGTGAGAAGAATGG + Intergenic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1061048958 9:128182918-128182940 TTAATTAAGACTGTGGAGGCCGG - Intronic
1061110298 9:128564684-128564706 GTGATTACGTCTGAGAAGGAGGG + Intronic
1061258759 9:129467694-129467716 TTGATTATGACTGAGTATGGGGG - Intergenic
1061567805 9:131455307-131455329 TTGATGATGGCTGTGAAGGAGGG + Intronic
1186082877 X:5952394-5952416 TTGAGTAGGTGTGAGAAGGATGG + Intronic
1186382614 X:9076862-9076884 TTGATTAAGAGTTGGAAGGGAGG + Intronic
1189866806 X:45338888-45338910 TTCCAAAAGACTGAGAAGGAGGG + Intergenic
1190475947 X:50827547-50827569 TTGATTAAGGGTGCAAAGGAAGG - Intergenic
1191189154 X:57647988-57648010 TTGATTCAGTCTGACAAGGCAGG + Intergenic
1192013094 X:67296563-67296585 ATGATGAAGGCTGAGAAGCATGG + Intergenic
1192129614 X:68536805-68536827 ATGCTTAAGACTGAGAAAAAGGG - Exonic
1193211779 X:78815210-78815232 TTAATAGAGACTGAGAAGGGTGG + Intergenic
1194163182 X:90481066-90481088 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1194871367 X:99136351-99136373 TTGATTAATAAAGAGAATGATGG - Intergenic
1194918512 X:99734371-99734393 GTGATTCAGGCTTAGAAGGAAGG - Intergenic
1195040307 X:101008054-101008076 TTCATTAAGACTGAGAATAGAGG + Intergenic
1197558007 X:127980674-127980696 TTCAATATGACTGATAAGGATGG + Intergenic
1198035215 X:132795133-132795155 TTCACTGAGACTGAGAGGGAAGG + Intronic
1198207059 X:134476633-134476655 CTGATTAAGACTGATGGGGATGG - Intronic
1200383424 X:155864675-155864697 TTCATTAAGACTGGGAGAGATGG - Intergenic
1200509456 Y:4058791-4058813 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1201263205 Y:12180587-12180609 TTGGTTCAGACTGGAAAGGAAGG - Intergenic
1201640156 Y:16169572-16169594 GTGATTAAAATTGAGAAGGCAGG + Intergenic
1201662658 Y:16415753-16415775 GTGATTAAAATTGAGAAGGCAGG - Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic