ID: 1077864731

View in Genome Browser
Species Human (GRCh38)
Location 11:6212589-6212611
Sequence CAAGAGGACGTTGTTTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864731_1077864734 4 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864734 11:6212616-6212638 TAACATTCTGCCTAGATTTCTGG 0: 1
1: 0
2: 2
3: 12
4: 176
1077864731_1077864738 30 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1077864731_1077864736 10 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864736 11:6212622-6212644 TCTGCCTAGATTTCTGGGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 170
1077864731_1077864735 5 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864735 11:6212617-6212639 AACATTCTGCCTAGATTTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864731 Original CRISPR CAAGAGGACGTTGTTTTGAA TGG (reversed) Intronic