ID: 1077864733

View in Genome Browser
Species Human (GRCh38)
Location 11:6212612-6212634
Sequence AAATCTAGGCAGAATGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864733_1077864738 7 Left 1077864733 11:6212612-6212634 CCTCTAACATTCTGCCTAGATTT 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864733 Original CRISPR AAATCTAGGCAGAATGTTAG AGG (reversed) Intronic