ID: 1077864733 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:6212612-6212634 |
| Sequence | AAATCTAGGCAGAATGTTAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 273 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 253} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077864733_1077864738 | 7 | Left | 1077864733 | 11:6212612-6212634 | CCTCTAACATTCTGCCTAGATTT | 0: 1 1: 0 2: 1 3: 18 4: 253 |
||
| Right | 1077864738 | 11:6212642-6212664 | TGGATCCATATCTACTATAAAGG | 0: 1 1: 0 2: 0 3: 6 4: 112 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077864733 | Original CRISPR | AAATCTAGGCAGAATGTTAG AGG (reversed) | Intronic | ||