ID: 1077864736

View in Genome Browser
Species Human (GRCh38)
Location 11:6212622-6212644
Sequence TCTGCCTAGATTTCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864731_1077864736 10 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864736 11:6212622-6212644 TCTGCCTAGATTTCTGGGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 170
1077864732_1077864736 -6 Left 1077864732 11:6212605-6212627 CCTCTTGCCTCTAACATTCTGCC 0: 1
1: 0
2: 1
3: 22
4: 278
Right 1077864736 11:6212622-6212644 TCTGCCTAGATTTCTGGGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864736 Original CRISPR TCTGCCTAGATTTCTGGGTC TGG Intronic