ID: 1077864737

View in Genome Browser
Species Human (GRCh38)
Location 11:6212626-6212648
Sequence GGATCCAGACCCAGAAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864737_1077864738 -7 Left 1077864737 11:6212626-6212648 CCTAGATTTCTGGGTCTGGATCC 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864737 Original CRISPR GGATCCAGACCCAGAAATCT AGG (reversed) Intronic