ID: 1077864737 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:6212626-6212648 |
| Sequence | GGATCCAGACCCAGAAATCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 199} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077864737_1077864738 | -7 | Left | 1077864737 | 11:6212626-6212648 | CCTAGATTTCTGGGTCTGGATCC | 0: 1 1: 0 2: 2 3: 16 4: 199 |
||
| Right | 1077864738 | 11:6212642-6212664 | TGGATCCATATCTACTATAAAGG | 0: 1 1: 0 2: 0 3: 6 4: 112 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077864737 | Original CRISPR | GGATCCAGACCCAGAAATCT AGG (reversed) | Intronic | ||