ID: 1077864738

View in Genome Browser
Species Human (GRCh38)
Location 11:6212642-6212664
Sequence TGGATCCATATCTACTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077864731_1077864738 30 Left 1077864731 11:6212589-6212611 CCATTCAAAACAACGTCCTCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1077864737_1077864738 -7 Left 1077864737 11:6212626-6212648 CCTAGATTTCTGGGTCTGGATCC 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1077864732_1077864738 14 Left 1077864732 11:6212605-6212627 CCTCTTGCCTCTAACATTCTGCC 0: 1
1: 0
2: 1
3: 22
4: 278
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1077864733_1077864738 7 Left 1077864733 11:6212612-6212634 CCTCTAACATTCTGCCTAGATTT 0: 1
1: 0
2: 1
3: 18
4: 253
Right 1077864738 11:6212642-6212664 TGGATCCATATCTACTATAAAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077864738 Original CRISPR TGGATCCATATCTACTATAA AGG Intronic