ID: 1077865470

View in Genome Browser
Species Human (GRCh38)
Location 11:6218034-6218056
Sequence CTGGAGACTCAGAGCCACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077865467_1077865470 -1 Left 1077865467 11:6218012-6218034 CCTGGTGAGCAAGGGGCTGGGCC 0: 1
1: 0
2: 4
3: 40
4: 321
Right 1077865470 11:6218034-6218056 CTGGAGACTCAGAGCCACCCAGG 0: 1
1: 0
2: 3
3: 36
4: 330
1077865459_1077865470 29 Left 1077865459 11:6217982-6218004 CCAGGGCTGGAGGCGGGGGATGC 0: 1
1: 0
2: 6
3: 62
4: 626
Right 1077865470 11:6218034-6218056 CTGGAGACTCAGAGCCACCCAGG 0: 1
1: 0
2: 3
3: 36
4: 330
1077865466_1077865470 0 Left 1077865466 11:6218011-6218033 CCCTGGTGAGCAAGGGGCTGGGC 0: 1
1: 0
2: 6
3: 34
4: 297
Right 1077865470 11:6218034-6218056 CTGGAGACTCAGAGCCACCCAGG 0: 1
1: 0
2: 3
3: 36
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077865470 Original CRISPR CTGGAGACTCAGAGCCACCC AGG Exonic
900159539 1:1217002-1217024 CTGGCGTGTCGGAGCCACCCAGG - Exonic
900315920 1:2056272-2056294 GTGCAGCGTCAGAGCCACCCCGG - Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
901031666 1:6310610-6310632 CTGAATCATCAGAGCCACCCAGG + Intronic
902262657 1:15238444-15238466 ATGGAAACTCAGGGCCACCAAGG + Intergenic
902392643 1:16115383-16115405 TTGGAGACTCAGGGACACCTGGG + Intergenic
902630424 1:17701438-17701460 CTGGGGCCTGAGAACCACCCAGG - Intergenic
902857557 1:19220039-19220061 ATGGGGACTGAGAGGCACCCTGG - Intronic
902880637 1:19369844-19369866 CTGCGGACTCAGAGCCCCACTGG - Intronic
903479805 1:23645007-23645029 CTGGGGACTGAGAGCCAAGCAGG - Intergenic
903557839 1:24206315-24206337 CGGGAGACCCAGAGCCAGCCTGG - Intergenic
904155882 1:28482729-28482751 CAGGAGTTTCAGAGCAACCCGGG + Intronic
904688575 1:32276915-32276937 CTGGAGACTCACCTCCAGCCGGG + Intronic
905396360 1:37669159-37669181 CTGGAGCCTCCGCGCCACCCTGG + Intergenic
905449462 1:38047159-38047181 CTGGAGACTCCGAGCCCGGCCGG + Intergenic
905848872 1:41258143-41258165 TTGGAGAGTCTGAGCCAACCTGG - Intergenic
909019003 1:70410983-70411005 CTGGCTCCTGAGAGCCACCCGGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
912953032 1:114133734-114133756 CTGGAGAGCCAGAGCAAACCGGG - Intronic
914676011 1:149908063-149908085 TTGGAGAATCAGATCCACCGAGG - Exonic
914848549 1:151296799-151296821 ATGGAGTCTCAGTGTCACCCAGG + Intronic
915135346 1:153727943-153727965 TTGGAGACTCAGCGCCACCGCGG + Intergenic
915831917 1:159139317-159139339 CTGATGACACACAGCCACCCTGG + Intronic
916784846 1:168079118-168079140 ATTGAGACTCAGAACCACCTCGG - Intergenic
917289202 1:173454778-173454800 AGGGAGACTCAGAGCAACTCAGG + Intergenic
917661343 1:177180283-177180305 ATTGAACCTCAGAGCCACCCAGG - Intronic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919186235 1:194154225-194154247 ATGGAGCCTCAGTGTCACCCAGG - Intergenic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
921546679 1:216482313-216482335 CTGCAACCTCAGGGCCACCCAGG + Intergenic
922167173 1:223125829-223125851 CTGAAGACTCTGAACAACCCTGG - Intronic
923037326 1:230293438-230293460 CTGGGTGCTCAGAGCCTCCCAGG - Intergenic
924253396 1:242158174-242158196 CAGGAGGCTCAGATCCACCTGGG - Intronic
1063071744 10:2672866-2672888 CTGGAGACAAAGAAACACCCTGG + Intergenic
1063189245 10:3678512-3678534 CTGGTGACCCAGGACCACCCAGG + Intergenic
1063708033 10:8450038-8450060 CTGGAGTCTCAGAGCTACTCTGG - Intergenic
1063903362 10:10758599-10758621 CTGGATACTGAGAGCCTTCCTGG + Intergenic
1065650530 10:27884684-27884706 CTGCAGACTCACAGACACCTGGG + Intronic
1069532634 10:69230405-69230427 CTGGAGATTCAGAGTCCCCAGGG - Intronic
1069740380 10:70683419-70683441 CTGAAGACCCACAGTCACCCTGG - Intronic
1070816171 10:79324926-79324948 CTGGGGACTCAGAGACTCCAGGG + Intergenic
1072220034 10:93319056-93319078 CTGGACAATCAGAGCATCCCTGG + Intronic
1072423027 10:95305564-95305586 ATGGAGTCTCACTGCCACCCAGG + Intergenic
1072439420 10:95440466-95440488 CTGGAGATTCAGCCCCACCTAGG - Intronic
1073190293 10:101646284-101646306 CAGGAGATTCTGAGCCAACCAGG + Intronic
1075729330 10:124626995-124627017 CTGGAGACTCAGTGGCATTCTGG - Intronic
1076239491 10:128893100-128893122 GGGGAGACTCAGAGCCAGGCTGG - Intergenic
1076800709 10:132826746-132826768 CTGGAGCCACAGAGCCAGGCAGG + Intronic
1077011505 11:381203-381225 ATGGGGACTCAGGGCCACCCAGG - Intronic
1077053857 11:580488-580510 CTGGGGACTCAGCAGCACCCTGG + Intronic
1077194795 11:1273934-1273956 CTAGAGACCCCGAGCCACCCTGG - Intergenic
1077201030 11:1307656-1307678 CAGGAGACTCAGAGCAACAAGGG - Intronic
1077865470 11:6218034-6218056 CTGGAGACTCAGAGCCACCCAGG + Exonic
1078018241 11:7633613-7633635 CTGGAGACTCAGCACCATTCTGG - Intronic
1078542279 11:12222087-12222109 CAGGAGACTCAGCGCTGCCCTGG - Intronic
1079304776 11:19312345-19312367 CTGCAGCCTCAGCTCCACCCTGG + Intergenic
1079409132 11:20170671-20170693 ATGGAGTCTCACAGTCACCCAGG + Intergenic
1079764895 11:24380138-24380160 CTGCAACCTCAGAGGCACCCTGG + Intergenic
1081623312 11:44632010-44632032 CAGGAGACCGAGAGCCACCCTGG + Intergenic
1081734637 11:45394363-45394385 CTGGAACCTCAGAGGCAGCCAGG - Intergenic
1081869477 11:46376812-46376834 CTGGAAGCCCAGAGCCATCCAGG + Intronic
1082114797 11:48316157-48316179 CAGCACTCTCAGAGCCACCCTGG + Intergenic
1082834296 11:57640295-57640317 CTGGAGGCTCAGACCCAGGCAGG - Intergenic
1084157443 11:67322042-67322064 CTGAAGTCTCACAGCTACCCAGG - Intronic
1084216315 11:67648668-67648690 CTGGCCACCCAGAGCCCCCCAGG - Intronic
1084505561 11:69564695-69564717 CAGGACACTCACAGCCACCCAGG + Intergenic
1085279979 11:75323754-75323776 CTGGGACCTCTGAGCCACCCAGG + Intronic
1086584380 11:88434198-88434220 CTGCAGCCTCATAGCCAACCAGG + Intergenic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1091362522 11:134988863-134988885 CTGGAGACACTGAGCATCCCAGG - Intergenic
1092281591 12:7101776-7101798 CTGGGGACTCAGGGACACCTGGG - Intronic
1094147243 12:27243744-27243766 GTGGGGACTCGAAGCCACCCAGG - Intergenic
1095310126 12:40688745-40688767 CTAGGGAGTCAGAGCCATCCAGG + Intergenic
1095482312 12:42649292-42649314 CTGGAGTCTCTGAGCCTACCTGG - Intergenic
1096048909 12:48588812-48588834 CTGGAAACACACAGCCTCCCAGG + Intergenic
1096077611 12:48815029-48815051 CTGGAGACACAGAGCCGAGCCGG + Intronic
1096470676 12:51873677-51873699 CTTGTAACTCAGAGCCAGCCAGG - Intergenic
1096695687 12:53346712-53346734 CTGGAGACAGAGAGTAACCCTGG + Intergenic
1097909801 12:64957706-64957728 GTGGAGACCCAGAGCAACCTTGG + Intergenic
1098028476 12:66230620-66230642 CTGGGGAACCAGAGCCTCCCTGG + Intronic
1098309704 12:69136208-69136230 CTGGAGTCTAATAGCCACCCTGG + Intergenic
1099184618 12:79503854-79503876 TTGGAGAGTCAGAGACAACCAGG + Intergenic
1102379633 12:112453274-112453296 CGAGAGAGCCAGAGCCACCCTGG + Exonic
1103540685 12:121664368-121664390 CTGGGGACTCAGAGACTTCCTGG + Intronic
1103666187 12:122567810-122567832 CTGGAGTCTCACTGTCACCCAGG - Intronic
1104264248 12:127216351-127216373 CTGGAAAATCAGAGCCGTCCAGG + Intergenic
1104925222 12:132310462-132310484 CTGGAGGCTGAGAGCCCTCCGGG + Intronic
1105291307 13:19055422-19055444 CTCGAGCCACACAGCCACCCTGG - Intergenic
1105930338 13:25046825-25046847 CTGGAGACTCAGGGCCCGTCTGG + Intergenic
1109563363 13:64078704-64078726 CTGAAAACACAGAGACACCCCGG + Intergenic
1111913293 13:94335363-94335385 CAGGAGTCTCCGAGCCACACTGG + Intronic
1112009190 13:95279830-95279852 CTGGAGCCACAGGGCCCCCCAGG + Intronic
1114991710 14:28296715-28296737 TTGGAGAGTCAGAGGCAACCAGG - Intergenic
1115430805 14:33316432-33316454 CTGCAGACTCAGAGAGACACAGG + Intronic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1119689972 14:76663911-76663933 CTCCATACTCAGAGCCAGCCAGG + Intergenic
1119806050 14:77483031-77483053 TTGGAGGCTCAGAGCTGCCCAGG - Intronic
1121405451 14:93716847-93716869 ATGGGGACTCAGGGCCAGCCTGG - Intergenic
1121647924 14:95534085-95534107 CTGGAAACTCAGAGGCGGCCGGG + Intronic
1122045177 14:99017863-99017885 CTGGAGACTCCTAGCCAGCAAGG + Intergenic
1122228846 14:100295056-100295078 TTGGATACTCAGTGCCACCTGGG + Intronic
1122626683 14:103088610-103088632 CTGTAGGCTCACAGCCTCCCAGG - Intergenic
1123149247 14:106165510-106165532 CTGCAAACACAGAGACACCCTGG + Intergenic
1123154519 14:106211243-106211265 CTGCAAACACAGAGACACCCTGG + Intergenic
1123162211 14:106289333-106289355 CTGCAAACACAGAGACACCCCGG + Intergenic
1123172724 14:106389697-106389719 CTGCAAACACAGAGACACCCTGG + Intergenic
1123180351 14:106463568-106463590 CTGCAAACACAGAGACACCCTGG + Intergenic
1123181070 14:106470572-106470594 CTGCAAACACAGAGACACCCTGG + Intergenic
1123192757 14:106586683-106586705 CTGCAAACACAGAGACACCCTGG + Intergenic
1123214153 14:106791005-106791027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123215216 14:106803005-106803027 CTGCAAACACAGAGACACCCTGG + Intergenic
1123216129 14:106810747-106810769 CTGCAAACACAGAGACACCCTGG + Intergenic
1202945838 14_KI270726v1_random:26207-26229 CTGCAAACACAGAGACACCCTGG - Intergenic
1202946545 14_KI270726v1_random:33084-33106 CTGCAAACACAGAGACACCCTGG - Intergenic
1123401147 15:19987969-19987991 CTGCAAACACAGAGACACCCTGG + Intergenic
1125351123 15:38768575-38768597 AAGGAGACTCAGAGCTACCATGG - Intergenic
1126127537 15:45309441-45309463 CTGGAGACTGAAAACAACCCAGG - Intergenic
1127974243 15:63985455-63985477 ACTGAGACTCAGAGCCACCCGGG - Intronic
1128710539 15:69868170-69868192 ATGGAGACTCAGGTCAACCCAGG + Intergenic
1129831555 15:78674233-78674255 CCAGAGACTCAGAGACAGCCAGG + Intronic
1130902987 15:88220893-88220915 CTGGAGGTTCAGAGGCATCCAGG - Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1132179048 15:99737957-99737979 CTGCTGACTCAGCCCCACCCAGG + Intergenic
1132226993 15:100150540-100150562 CTGGGGACTCACAGTCTCCCAGG - Intronic
1132897047 16:2234042-2234064 CTGGACACCCAGAAGCACCCCGG - Intronic
1133282762 16:4676500-4676522 CTTGAGGCTCAAAGCCACACGGG - Intronic
1133905528 16:10018779-10018801 CTAGAGAATCAGAGCAACCTCGG - Intronic
1134308554 16:13055696-13055718 CTGGAGGCTGTGTGCCACCCAGG + Intronic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137554979 16:49464845-49464867 CAGGACACACAGAGCCACACAGG + Intergenic
1138545693 16:57718186-57718208 ATGGACTCTCAGAGCCACCTGGG + Intronic
1139432024 16:66915873-66915895 ATGGAGACTCACTGTCACCCAGG - Intronic
1139473991 16:67193340-67193362 CTGGGGACTCAGGTCCACCGGGG - Intronic
1141496101 16:84410763-84410785 CTGGTAAGTCAGAGCCTCCCTGG + Exonic
1141694167 16:85612105-85612127 CCGGGGCCTCAGAGCCGCCCGGG + Intronic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1142220678 16:88853510-88853532 GTGGAGAGTCAGGGCCACCCAGG - Intronic
1203143854 16_KI270728v1_random:1786654-1786676 CTGGTGACTCCGAGGGACCCGGG - Intergenic
1142743976 17:1945972-1945994 GAGGAGACTCAGAGCCTCCAGGG + Intronic
1143239528 17:5432030-5432052 GTGGAGAGGCTGAGCCACCCAGG + Intronic
1143925223 17:10363610-10363632 CGGGGGACTCACAGCCTCCCTGG - Intronic
1144314900 17:14050382-14050404 CGGGAGAATCACTGCCACCCAGG + Intergenic
1144764001 17:17723149-17723171 CTGGACACTCAGCCCCACGCAGG + Intronic
1144815062 17:18028187-18028209 CTGGACCCTGAGACCCACCCAGG - Intronic
1144961816 17:19048800-19048822 CTGGAGTCCCTGAGCCAACCAGG + Intergenic
1144973345 17:19125722-19125744 CTGGAGTCCCTGAGCCAACCAGG - Intergenic
1145959840 17:28880968-28880990 CTCGAGACTAAGGGCCACCCAGG - Intronic
1146662069 17:34671378-34671400 CTGCAGCCTCAGAGCCAGCATGG + Intergenic
1148346813 17:46908722-46908744 CCGGAGACTCAGTGCCTCCCAGG + Intergenic
1148380214 17:47191153-47191175 AGTAAGACTCAGAGCCACCCTGG + Intergenic
1150432925 17:65132886-65132908 CTGGAGTTTCAGACCCAACCTGG - Intergenic
1152185103 17:78851030-78851052 CTGGAGAATAAGAGAGACCCGGG + Intergenic
1152214671 17:79025154-79025176 CTGGAGCCTCTGAGCCGCCCTGG + Intronic
1152738939 17:82010797-82010819 CAGGACCCTCAGAGCCACCTAGG - Exonic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1154489311 18:14907477-14907499 CTGGAGACACTGAGCATCCCAGG + Intergenic
1155252283 18:23964064-23964086 CTGGGGACTCAGAATCACCAGGG - Intergenic
1157286796 18:46382384-46382406 TTGCAGACTCAGACCCAGCCAGG - Intronic
1157614892 18:48980623-48980645 ATGGAGACTCACAGCCAGCCTGG + Intergenic
1160182489 18:76647701-76647723 CTGGAGAGTCTGAGCCAACCTGG - Intergenic
1160262851 18:77311429-77311451 CTGGAGCCACAGAGGCTCCCAGG + Intergenic
1160515318 18:79476274-79476296 CTGGAGCCACAGAGCCACGGTGG - Intronic
1160565228 18:79782935-79782957 CTCGGGCTTCAGAGCCACCCTGG + Intergenic
1160565607 18:79785027-79785049 CTGGCGGCTCAAACCCACCCCGG - Intergenic
1160661145 19:299628-299650 CTGGAGACTGTGGGACACCCAGG + Intergenic
1160661441 19:301011-301033 CTGGAGACTGTGGGACACCCAGG + Intergenic
1160661474 19:301173-301195 CTGGAGACTGTGGGACACCCAGG + Intergenic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1161033850 19:2073047-2073069 CAGGAGCCTGGGAGCCACCCAGG + Exonic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1161839401 19:6669941-6669963 CAAGAGACCCAGACCCACCCGGG + Exonic
1162111649 19:8403065-8403087 CTGGGGACACAGAGACCCCCTGG + Intronic
1162398924 19:10432930-10432952 CTGGAGACACTGAGCCAGGCAGG - Intronic
1162447153 19:10730572-10730594 TTGGAGACTCACAGCCTGCCTGG + Intronic
1163020037 19:14476962-14476984 CTGGTGACTCAGGGCATCCCCGG - Intergenic
1163797435 19:19345699-19345721 CTGACAACTCAGAGCCATCCTGG + Intronic
1164400179 19:27896668-27896690 CTGCAGCCTCAGAGCAGCCCAGG - Intergenic
1165939642 19:39408588-39408610 CGGGAGAGTCAGAGCCCCCCAGG - Exonic
1166708815 19:44924265-44924287 CTGCAGGCTCAGAGGCACACAGG + Intergenic
1167047957 19:47062268-47062290 CTAGAGCCTCAGAGGCAGCCTGG + Intergenic
1167052792 19:47089917-47089939 CTGGGGCATCGGAGCCACCCGGG - Intronic
1167120265 19:47512557-47512579 CCAGACACCCAGAGCCACCCAGG + Intronic
1168124917 19:54277823-54277845 CTGGACACTCAAAGCTGCCCTGG + Intronic
1168125275 19:54279292-54279314 CTGGAGACTCAGGGAGACTCAGG + Intronic
1168169202 19:54575064-54575086 CTGGAGACTCAGGGAGACTCAGG - Intronic
1168171983 19:54595433-54595455 CTGGAGACTCAGGGAGACTCAGG - Intronic
924996888 2:369703-369725 ATGGAGACTCACTGTCACCCAGG + Intergenic
926453895 2:13040546-13040568 CTGGAGAGTCAGGGCAGCCCAGG + Intergenic
926901150 2:17753534-17753556 CTGGCGACCCCCAGCCACCCGGG - Intronic
927471438 2:23380583-23380605 TTTGGGAATCAGAGCCACCCAGG + Intergenic
928086607 2:28350072-28350094 GAGGAGGCTCAGAGCCACCCTGG + Intergenic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
929552577 2:42903838-42903860 CATGAGACCCACAGCCACCCTGG - Intergenic
929824021 2:45296038-45296060 CTGGATCCTCACAGGCACCCTGG + Intergenic
931119674 2:59202241-59202263 CTGCACACTCAGAGTCAACCTGG - Intergenic
932362146 2:71118112-71118134 ATGGGGAGTCAGAGCCACACAGG - Intronic
932842072 2:75092693-75092715 CTGGAGACTCAGAGCCCCACTGG + Intronic
934502976 2:94873670-94873692 CCTGAGACTCAGAGCCAGCAGGG + Intronic
935372325 2:102360024-102360046 ATGGAGATTCAAATCCACCCAGG + Intronic
937451748 2:122007937-122007959 CTTGAGAGTCAGGGACACCCAGG + Intergenic
937851976 2:126643941-126643963 CTGGAGCATCTGAACCACCCAGG + Intergenic
942563549 2:177245103-177245125 CTAGAGACTCAGAGCCTCTTGGG - Intronic
945367968 2:208979511-208979533 CTGAACACTCAGACTCACCCTGG - Intergenic
948800663 2:240432036-240432058 CTGGACACTCAGTGGTACCCTGG - Intergenic
949045374 2:241870338-241870360 CTTGTGACCCACAGCCACCCCGG - Intronic
1168899947 20:1354880-1354902 GGTGAGACTCAGAGCCACACTGG - Intronic
1170298251 20:14852887-14852909 CTGTAGACTCCGAGCCACAGTGG - Intronic
1170625318 20:18025846-18025868 ATGGAGAATCAAAACCACCCAGG - Intronic
1171768943 20:29306909-29306931 TTGGAAACCCGGAGCCACCCCGG - Intergenic
1171816016 20:29786766-29786788 CTGAACACTCAGGGCTACCCAGG - Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1173741724 20:45406629-45406651 CTGGAGGCGCAGCCCCACCCCGG + Intronic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1174341780 20:49901643-49901665 CTGGAGACGCACACCTACCCTGG - Intergenic
1174420391 20:50395601-50395623 CTGGAGAAGCAGAACCACCCTGG - Intergenic
1174577566 20:51547447-51547469 CTGGGGACGCAGAGCCACCTTGG - Intronic
1175966485 20:62662409-62662431 CTGGGGGCTCACAGCCACGCTGG - Intronic
1176056188 20:63150535-63150557 GGGGAGACTGAGACCCACCCAGG + Intergenic
1176220442 20:63967066-63967088 CCCCAGACTCAGAGCCCCCCCGG + Intronic
1177118731 21:17116100-17116122 CTGCAGCCTCAGAGCCTCCTTGG - Intergenic
1179174869 21:39001008-39001030 CAGTAGGCTCAGCGCCACCCTGG - Intergenic
1179718972 21:43304838-43304860 CTGAGGACCCACAGCCACCCCGG - Intergenic
1179922402 21:44514204-44514226 ATGGAGACTCAGACACAGCCAGG + Intronic
1180086399 21:45509720-45509742 CTGGCGGCTCAGGGCCACTCAGG + Intronic
1180155897 21:45977335-45977357 CTGGAGACTCAGATCCCCCCAGG + Intergenic
1180787681 22:18556154-18556176 CTGGAGCCGCAGGGCCACCCAGG + Intergenic
1180802453 22:18638236-18638258 CTGGAGAATGACAGCCACACAGG - Intergenic
1180925925 22:19555046-19555068 CTGGAGTCACAGAGCCCTCCTGG + Intergenic
1181072473 22:20354281-20354303 CTGGAGACTGTGAATCACCCAGG - Intronic
1181108439 22:20588046-20588068 CTGGATGCTCAGACCCACCTGGG - Intergenic
1181219270 22:21357025-21357047 CTGGAGAATGACAGCCACACAGG + Intergenic
1181234058 22:21439152-21439174 CTGGAGCCGCAGGGCCACCCAGG - Intronic
1181244589 22:21495679-21495701 CTGGAGCCGCAGGGCCACCCAGG + Intergenic
1182294398 22:29304687-29304709 CTGGAGCCTCAGAGGAAACCAGG - Intergenic
1182416421 22:30224174-30224196 CAGGTGACTCAGAGCCACTTTGG - Intergenic
1183341602 22:37284738-37284760 CTGGTGACTCAGGGGCCCCCAGG + Intronic
1184553606 22:45219615-45219637 ATGGAGTCTCAGTGTCACCCAGG + Intronic
1185075873 22:48681993-48682015 CTGGAGACTCGGGGCCTCCCAGG + Intronic
1185193145 22:49451604-49451626 CTGGAGTCTCAGACCCACGTGGG + Intronic
1185222920 22:49637963-49637985 GTGGAGCCTCGAAGCCACCCTGG + Intronic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
950191073 3:10976532-10976554 CTGGGGACTAAGAGGCATCCAGG - Intergenic
950639474 3:14339592-14339614 TGGGAGACTCTGAGCCAGCCTGG + Intergenic
950715896 3:14847732-14847754 CTGGAGACTGAGCTCCTCCCGGG + Intronic
954596169 3:51826877-51826899 CTGGGGATGCAGAGCCACTCTGG - Exonic
956444219 3:69309653-69309675 CAGGAGTTTCAGAGCCACCTAGG - Intronic
957629786 3:82704140-82704162 CTGGACACATAGAGCCTCCCAGG - Intergenic
959501073 3:107106567-107106589 CGAGAGAGCCAGAGCCACCCTGG - Intergenic
960918274 3:122719650-122719672 CCCGAGACTCTGAGCAACCCTGG + Intronic
960936595 3:122907954-122907976 CTGGGGTCTCAGAGCCCCCTTGG - Intergenic
961824146 3:129589994-129590016 GTGGAGACGCAGAGCCAGCCGGG - Intronic
963028304 3:140941951-140941973 CTGGAGACGCACAGCGCCCCGGG - Exonic
966880207 3:184345720-184345742 CTGGCGCCTCACAGCCAGCCGGG + Intronic
967976070 3:195035450-195035472 CTGAGGACCCAGAGCCACGCGGG + Intergenic
969445397 4:7242069-7242091 CAGGACCCTCAGACCCACCCTGG + Intronic
969631591 4:8341844-8341866 CAGGAGACTCAGAGCCAGAGCGG - Intergenic
978578680 4:110211234-110211256 CTGGGGACTCAGGGCCTCTCTGG + Intergenic
978619871 4:110627499-110627521 CTGGAGACTCAGTGACACCTAGG - Intronic
982131110 4:152229389-152229411 CTGGAGACTCACAGGGACACAGG + Intergenic
982401560 4:154973398-154973420 TTAGAGACTCAGAGCCAGCAGGG - Intergenic
985824601 5:2183135-2183157 CTGGGGCTTCAGAGCCATCCAGG + Intergenic
987844722 5:23268289-23268311 CTGGAGTCTCTGAGCCTACCCGG - Intergenic
990445795 5:55892715-55892737 CTTGAGACTCTGAGCCACGATGG - Intronic
991049132 5:62254028-62254050 CTGGAGACTCAAGGCCACATCGG + Intergenic
997248635 5:132371941-132371963 ATGGAGTCTGAGAGCTACCCTGG + Intronic
997846495 5:137291221-137291243 CTGGAGGAGCAGAGCCACCAGGG + Intronic
998105993 5:139469583-139469605 CTGGAGAGCCAGAGACACCCTGG - Intergenic
998241288 5:140447414-140447436 CTGGAGGTTGAGAGCCACCTGGG - Intronic
999147466 5:149405776-149405798 CTGGGGACACAGAGCCTGCCAGG + Intergenic
1000038737 5:157468914-157468936 CTGGAGGCTGAGACCAACCCAGG - Intronic
1001482317 5:172096688-172096710 TTGGAGACCCAGAGACAGCCTGG + Intronic
1001810254 5:174622177-174622199 GTGCAGACTCAGAGTCACCTGGG - Intergenic
1001844026 5:174904723-174904745 CTGGAGACTCCAAGCCAGCAGGG + Intergenic
1001889589 5:175327923-175327945 CTGGAGCTTCAGTCCCACCCTGG - Intergenic
1001894086 5:175363796-175363818 CTGGGGCCACAGAGCCAACCTGG - Intergenic
1002214311 5:177618991-177619013 CTGGACTGTCAGAGCCACTCCGG + Intergenic
1002836934 6:872919-872941 CTGGAGAAACAGCCCCACCCTGG + Intergenic
1003737488 6:8893089-8893111 CTGAAGACTCAGAACCTCCTAGG - Intergenic
1004668886 6:17776901-17776923 TGGCAGACTCAGAGCCACCAGGG + Intronic
1005659662 6:27983566-27983588 CTGCAGACCCACTGCCACCCTGG + Intergenic
1005719385 6:28586499-28586521 CAGTTGACTCAGAGCCTCCCTGG + Exonic
1005838297 6:29723985-29724007 CCGGAGACTCTGAGGGACCCGGG - Intronic
1006052764 6:31356611-31356633 CCGGAGACTCGGGGCGACCCGGG + Intronic
1007230176 6:40342769-40342791 TTAGAGACTCAGAGCCGCCCTGG - Intergenic
1007271183 6:40638414-40638436 CTGGAGACCCTGAGCCATTCTGG + Intergenic
1007293177 6:40802209-40802231 CTGGAAGCTCAGAGACACACAGG + Intergenic
1009909250 6:69905087-69905109 CTGCAGCCACAGAGCCAACCCGG + Intronic
1010535181 6:77017987-77018009 CTGGAGAATCACAGCATCCCAGG + Intergenic
1010778771 6:79918699-79918721 CTGGAAATTCAAAGCCAACCTGG - Intronic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013356544 6:109350364-109350386 CTGGAGTCTCAAAGTGACCCAGG + Intergenic
1015863712 6:137706780-137706802 CGAGAGAGCCAGAGCCACCCTGG - Intergenic
1015925772 6:138308909-138308931 CTCCAGCCACAGAGCCACCCTGG - Intronic
1016219734 6:141653846-141653868 CTGAAGACCCAGAGACACACAGG - Intergenic
1016389744 6:143562602-143562624 CTTGAAACTCAGAGTCACACTGG - Intronic
1017139625 6:151178878-151178900 CTGGGTTCTCACAGCCACCCTGG - Intergenic
1018706142 6:166464504-166464526 CTGGAGACACACAGTCACCAGGG - Intronic
1018764951 6:166925700-166925722 GTGGAGGCGCAGAGCCACCCAGG + Intronic
1019190672 6:170249029-170249051 GTGGAGACCCAGCCCCACCCCGG + Intergenic
1019424025 7:964725-964747 CTGGAGGCCCAGAGCCCCCCAGG - Intronic
1020274506 7:6616039-6616061 CAGGAGGCGCAGGGCCACCCCGG - Exonic
1021521383 7:21542858-21542880 CTGGGGGCTCAGACCCACCCCGG + Intergenic
1022805332 7:33815520-33815542 CTGGAGACCTAGAGCCTCACGGG + Intergenic
1023174674 7:37424249-37424271 CTGGAGATTCGGAGCTGCCCAGG - Intronic
1024273548 7:47659863-47659885 CTGGGGAGCCAGAGCCACCAAGG + Exonic
1025250584 7:57348889-57348911 CTGGAGAAGCAGAACCACCCTGG + Intergenic
1025807641 7:64850096-64850118 CAGAAGACTCAGAGCCCACCGGG + Intergenic
1026118357 7:67515344-67515366 ATGGAGTCTCACTGCCACCCAGG + Intergenic
1027050664 7:75019421-75019443 TAGGAGACACAGACCCACCCCGG + Intronic
1028483663 7:91335295-91335317 CTGGAGACGCTGAGACACTCAGG - Intergenic
1028525282 7:91777816-91777838 ATGGAGAATCAGAGCAAGCCTGG - Intronic
1028606380 7:92660759-92660781 CTGGGTCCTCAGAGTCACCCTGG - Intronic
1029420321 7:100468555-100468577 CTGGAGACTCAGGGACCCTCTGG - Intronic
1029603406 7:101583412-101583434 CCGAAGACTCAGTGCCACCATGG + Intergenic
1031198401 7:118646104-118646126 CAGCAGACTCAGAGACACCAGGG + Intergenic
1031979176 7:128113296-128113318 CTGGACACACAGGCCCACCCAGG - Intergenic
1032003748 7:128283818-128283840 CTGGTGGCTCAGGCCCACCCTGG - Intergenic
1032779274 7:135150452-135150474 CTGGGGAATCAGTGCCACACAGG - Intronic
1032797296 7:135288291-135288313 GTGGACACTCAGTGCCAGCCAGG - Intergenic
1034259659 7:149746855-149746877 ATGGAGACAGAGAACCACCCTGG - Intergenic
1034277895 7:149831709-149831731 CCCAAGACTCAGAGCCAGCCTGG - Intergenic
1034425510 7:151011950-151011972 CTGGTGATTCAAATCCACCCAGG + Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1035081083 7:156216546-156216568 TTGGAGACTCAGAGACAGACAGG - Intergenic
1035677929 8:1468131-1468153 CTGGGGACTCAGGGCCTGCCTGG - Intergenic
1035677959 8:1468272-1468294 CTGGGGACTCAGGACCAGCCCGG - Intergenic
1037717314 8:21411411-21411433 CTGGAGACACAGTGACACACAGG + Intergenic
1038414088 8:27380633-27380655 TAAGAGACTCAGAGACACCCAGG + Intronic
1038890949 8:31722441-31722463 CTGGGGACTCTGTGCCACCGTGG - Intronic
1040285847 8:46099998-46100020 CAAGAGACACAGAGGCACCCTGG - Intergenic
1040341887 8:46445247-46445269 CTGAAGATTTAGAGCCAGCCTGG + Intergenic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041474581 8:58249265-58249287 CTGGAGAGTCAGGGCAGCCCTGG + Intergenic
1041560761 8:59215494-59215516 CAGGAGACCCATAACCACCCAGG + Intergenic
1041902998 8:63002511-63002533 CGTGAGCCTCAGCGCCACCCAGG - Intergenic
1044125763 8:88456895-88456917 TTGGAGAGTCTGAGCCAACCTGG + Intergenic
1045436022 8:102165307-102165329 CAGTAGAATCAGACCCACCCAGG + Intergenic
1045496553 8:102714362-102714384 CTGGAGACACAGAGACACACAGG - Intergenic
1046185387 8:110708270-110708292 CTGAAGATCCAGACCCACCCAGG + Intergenic
1047203452 8:122784919-122784941 CTGGGGAGACAGAGCCCCCCTGG + Intronic
1049011821 8:139892327-139892349 CTGGAGTCTCAGGGCCACCTTGG - Intronic
1049680574 8:143916185-143916207 CGGCAGACTCAGGGCCCCCCAGG + Exonic
1049821367 8:144635677-144635699 CGGGAGACTCAGATCCCACCGGG - Intergenic
1051510368 9:17870820-17870842 CTGGAAACTCAGGGAAACCCAGG + Intergenic
1051584219 9:18710147-18710169 CTGGAGTGACAGAGCCGCCCTGG - Intronic
1051691082 9:19712932-19712954 CTGGAGAGGCAAAGTCACCCTGG + Intronic
1051758609 9:20435047-20435069 TTAGAGACTCAGAGCCTGCCTGG + Intronic
1055012243 9:71579629-71579651 TTGGAGCCTCAGATCCACTCTGG + Intergenic
1056767681 9:89454924-89454946 GTGAAGAGGCAGAGCCACCCGGG - Intronic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1057904468 9:98973629-98973651 GTGGAAACTCAGCCCCACCCAGG - Intronic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059990332 9:119859325-119859347 AAGGAGACCCAGAGCAACCCAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060892226 9:127196211-127196233 CTCGAGCCTCATAGCCACCAGGG + Intronic
1061322351 9:129839268-129839290 CTGGACCCTCACAACCACCCTGG - Intronic
1061383560 9:130275233-130275255 CAGGAGCCCCAGAGACACCCAGG - Intergenic
1061803649 9:133126627-133126649 CTGGGGAGTCACTGCCACCCCGG + Intronic
1061997523 9:134194073-134194095 CAGTAGACACAGAGCTACCCAGG + Intergenic
1062101900 9:134732881-134732903 CTGGGGTCTCAGAGCCACTAAGG + Intronic
1189317311 X:40065177-40065199 CTGTAGGCCCAGAGCCCCCCAGG - Intronic
1189458541 X:41217035-41217057 ATGGAGACTCACTGTCACCCAGG - Intronic
1189875702 X:45433885-45433907 GGTGAGACTCAGAGCCACGCTGG - Intergenic
1192174704 X:68878449-68878471 CTGGATACTCAGAGGTATCCAGG + Intergenic
1192327573 X:70146099-70146121 CTGAAGACTCATAACCACCCTGG - Intronic
1196769693 X:119281438-119281460 ATGGAGAATCAGAGGCACCCAGG - Intergenic
1197835609 X:130690684-130690706 TTAGAGACAAAGAGCCACCCAGG - Intronic
1201973317 Y:19819046-19819068 GTGGAGACTCTGAGCCAACTGGG + Intergenic