ID: 1077866835

View in Genome Browser
Species Human (GRCh38)
Location 11:6229406-6229428
Sequence TAGGATCAGGAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077866835 Original CRISPR TAGGATCAGGAGAAGGAAGC AGG (reversed) Intronic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
902439687 1:16421434-16421456 GGGGATCAGGAGGAGGAAGAGGG - Intronic
902652979 1:17848704-17848726 TTTGCTCTGGAGAAGGAAGCAGG - Intergenic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
905232044 1:36520605-36520627 TAAGATCAGGAGACAGGAGCAGG - Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906779942 1:48564365-48564387 ATGGGTCAGGAGAAGGCAGCAGG - Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907111148 1:51927689-51927711 TGGGATCAGGAGACTGAGGCAGG + Intronic
908166411 1:61463472-61463494 TAGGAGGAGGAGGAGGAAGAGGG - Intergenic
908325869 1:63023107-63023129 TAAGAGCAGGTGAAGGAAGAGGG + Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911796836 1:102087247-102087269 TGGCATCAGAAGATGGAAGCTGG + Intergenic
912594064 1:110856639-110856661 TAGGAACCAGAGAAGGAGGCAGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912771430 1:112467233-112467255 CTAGATCAGGAGAAGTAAGCAGG + Intronic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
915185788 1:154104261-154104283 TAGGAGGAGGAGAAGCAAGATGG + Intronic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
916220979 1:162445046-162445068 CAGGATCAGGACTAAGAAGCAGG + Intergenic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
917434662 1:175008281-175008303 TAAGGTCAGGAGAAGGCAGTTGG - Intronic
917725094 1:177820669-177820691 TAGGATCAGGAAGGGGAATCAGG - Intergenic
918325062 1:183402257-183402279 TAGGTTCAGGACAAGAAAGGAGG - Intronic
918446748 1:184624388-184624410 TAGCATCTGGAAAAGGAACCTGG + Exonic
918866340 1:189905512-189905534 TAGGACCAGGAGGAGGTAACTGG - Intergenic
920188270 1:204175979-204176001 GAGGAGGAGGAGAAGGAAGGAGG - Intergenic
920380981 1:205534432-205534454 ATGGCTCCGGAGAAGGAAGCTGG + Intergenic
920654777 1:207867393-207867415 TGAGATCAGGAGAAGGAGCCAGG + Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921483722 1:215692308-215692330 CAGGAACAGGAGATGGTAGCTGG + Intronic
921713182 1:218393460-218393482 CAAGATCAGTAGAAGGAAGCCGG - Intronic
922576273 1:226662937-226662959 TCTGGTCAGGAGAGGGAAGCTGG - Intronic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923110239 1:230884436-230884458 TAGGATCATGAGAGGGATGTAGG + Intergenic
924691104 1:246351736-246351758 TAGAAGCGGGGGAAGGAAGCTGG + Intronic
924723465 1:246645052-246645074 GCAGATCAGGAGAAGGAAGAAGG - Intronic
924876870 1:248115677-248115699 TGGCATCAGGAGACGGAGGCTGG + Intergenic
924934858 1:248759067-248759089 TAGGGTCAGGTCAGGGAAGCTGG + Intergenic
1063118791 10:3089864-3089886 TGGGAAAAGTAGAAGGAAGCAGG - Intronic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1064036626 10:11918758-11918780 TGTGATCAGGAGAGGTAAGCAGG - Intergenic
1064313926 10:14237164-14237186 TAGGATGAGGAGATAGAACCTGG + Intronic
1064326508 10:14356180-14356202 TAGCATCAGGAGAGAGAAGGTGG + Intronic
1064852329 10:19722710-19722732 GGGGGTCAGGAGAAAGAAGCAGG + Intronic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1065813867 10:29467277-29467299 TGCGATCTGGGGAAGGAAGCCGG - Intronic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1065876122 10:29998933-29998955 TAAAAACGGGAGAAGGAAGCAGG + Intergenic
1066449250 10:35512901-35512923 GATGATGAGGAGGAGGAAGCAGG - Intronic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069063594 10:63919606-63919628 TGCGGTCAGCAGAAGGAAGCAGG + Intergenic
1069851052 10:71405240-71405262 TCGGAGCAGGAGAAGGAACATGG - Intronic
1071238732 10:83680175-83680197 GAGGTTCTTGAGAAGGAAGCAGG + Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071906090 10:90175302-90175324 TGGGAGCAGGAGGAGGAAGCTGG - Intergenic
1072965087 10:99964945-99964967 TAGCTTCAGGAAAAGGAAGAAGG + Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073158668 10:101370413-101370435 TACCATCAGGATAAGGAAGAAGG - Intronic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073328843 10:102657893-102657915 GATGGTGAGGAGAAGGAAGCAGG - Exonic
1073718289 10:106135032-106135054 TAGGATAAGGAGATTGAAGGAGG + Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1075083695 10:119400318-119400340 AAGGATGTGGAGGAGGAAGCTGG + Intronic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1076068095 10:127464703-127464725 TAGGAGCAGGAGGAGGATGGGGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076182199 10:128418983-128419005 TGGGAGCAGGAGGAGGGAGCAGG + Intergenic
1077090292 11:775316-775338 CACGTCCAGGAGAAGGAAGCTGG + Intronic
1077760538 11:5091411-5091433 TAGAATCAGAAAAAGGAAGTAGG - Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078298487 11:10100673-10100695 ACTGATCAGGAGAAGGAAGGAGG - Intronic
1078654886 11:13229398-13229420 TGGTAAGAGGAGAAGGAAGCAGG - Intergenic
1079064089 11:17274795-17274817 TAGGAGCAGGAGACTGATGCAGG - Intronic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1080229501 11:30003069-30003091 TAGGAACAGGAGCAGGGAGGAGG - Intergenic
1080396226 11:31892769-31892791 TTTGATGGGGAGAAGGAAGCAGG - Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081215356 11:40389883-40389905 TAGGATAAGTAGAAAGAAGTAGG + Intronic
1082934819 11:58645655-58645677 TGGGATCTGGAGAAGGATGGTGG + Intronic
1082995201 11:59248691-59248713 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083002104 11:59301981-59302003 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083479352 11:62933758-62933780 TGGGATCAGGGCAAGGAAGCGGG + Intergenic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083731520 11:64654936-64654958 TAGGATCCTGAGCAGGAAGTAGG + Intronic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1084956820 11:72696022-72696044 TAGGAGCAGGACTGGGAAGCTGG + Intronic
1085013639 11:73158420-73158442 TAGGATGGGGAGAAGGAGACAGG - Intergenic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085792856 11:79510935-79510957 AAGGACCAGGAGTAGGAAGAGGG - Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087708805 11:101525820-101525842 GAGGATCAGGGTCAGGAAGCAGG + Intronic
1088720041 11:112584341-112584363 TGGGATCAGGAGGAAGAAGATGG + Intergenic
1088732060 11:112692364-112692386 TAGTATCCTAAGAAGGAAGCTGG - Intergenic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1090403688 11:126464983-126465005 GAGGAACAGGAGAGGGAAGGAGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091007742 11:131968825-131968847 AAGGATCAGGAGAATTAAGGGGG - Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092511262 12:9159216-9159238 TAGCAACATGAGAAGGAAGAGGG + Intronic
1092586229 12:9904173-9904195 TGGCATCAGGAGATGGAAGCTGG + Intronic
1092938245 12:13383923-13383945 TAGGATAAGGCCAGGGAAGCGGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094056130 12:26271545-26271567 GAGGACCAGGAGGAGGAAGACGG + Intronic
1094753952 12:33444305-33444327 TAGGTTTAGAAGATGGAAGCTGG - Intergenic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095986758 12:48004427-48004449 TTGGAGCAGGAGGGGGAAGCGGG + Exonic
1096243109 12:49969898-49969920 TAGGGTGAGGAGGAGCAAGCCGG + Intronic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096376703 12:51118094-51118116 TATGATTAGGAAGAGGAAGCTGG + Intronic
1096718908 12:53506940-53506962 GAGGAAGAGGAGAAGGAAGGGGG - Intronic
1096820244 12:54228143-54228165 TATCTTCTGGAGAAGGAAGCTGG - Intergenic
1097269061 12:57763250-57763272 TAGGATCTGGAAAGGGAAGAAGG + Exonic
1097510017 12:60527991-60528013 TAGGATGTGGAGAAAAAAGCTGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1099659979 12:85545148-85545170 AAGGAGGAGGAGAAGGTAGCAGG - Intergenic
1099842278 12:87981225-87981247 TAGGATCAGTAGCAGGGAGGTGG - Intronic
1100394441 12:94172212-94172234 TAGGAGGAGGAGAAGAAAGAGGG + Intronic
1100795933 12:98181909-98181931 GAGGATGAGGAGAAGGCATCAGG + Intergenic
1101578454 12:106019759-106019781 TAGGAGGAAGAGCAGGAAGCAGG - Intergenic
1102990133 12:117309481-117309503 AAGCATCAGGAAAATGAAGCCGG + Intronic
1104417231 12:128605667-128605689 TCGGCTGAGGAGAAGGAAGTGGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1104904988 12:132208319-132208341 GAAGATCAGGTGAAGGAGGCCGG + Intronic
1105225745 13:18429929-18429951 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1105341429 13:19529631-19529653 AGGGATCAGGAGAAGAAAGTAGG - Intronic
1105545281 13:21346605-21346627 GAGGATGAGGGGAATGAAGCGGG - Intergenic
1106266572 13:28115811-28115833 TGGCATCAGGAGTTGGAAGCTGG + Intergenic
1106335271 13:28777974-28777996 GAGGCTCAGGAGAAGGTGGCAGG + Intergenic
1106391462 13:29339037-29339059 GAGGCTCAGGAGAAGGTGGCAGG + Intronic
1106695260 13:32166071-32166093 TGGGATCAGGAGCACTAAGCAGG - Intronic
1107838582 13:44433104-44433126 TAGGATCAAAAGACGGAAGTTGG - Intronic
1108068462 13:46603289-46603311 CAGGGTCAGGAGGAGGAAACTGG - Intronic
1109415179 13:62029646-62029668 TGCAATTAGGAGAAGGAAGCAGG + Intergenic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1113249689 13:108438232-108438254 TAGGAAGAGCTGAAGGAAGCAGG - Intergenic
1113316757 13:109188790-109188812 AATGTTCAAGAGAAGGAAGCAGG + Intronic
1113566745 13:111323851-111323873 AAGGAGGAGGAGGAGGAAGCTGG - Intronic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1114010199 14:18358280-18358302 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115167527 14:30465604-30465626 TAGGATATGGAGAATGAAGTTGG - Intergenic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1115915709 14:38311127-38311149 TAGGATAAGGAGAAGAAATGAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116559010 14:46353101-46353123 TTGGATGAGGAGCTGGAAGCAGG - Intergenic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118899447 14:69974267-69974289 GAGGATCAGAGGAAGGAGGCAGG + Intronic
1118903628 14:70006842-70006864 TAAGATCATCACAAGGAAGCTGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119587010 14:75845556-75845578 GAGGAACAGGAGAAGGAAAAGGG + Intronic
1121358415 14:93233629-93233651 TATCAACAGGAGAAGGAAGTCGG - Intergenic
1122327118 14:100889461-100889483 GAGGAACAGGAAATGGAAGCTGG - Intergenic
1126937799 15:53730631-53730653 TAGGAAGAAGAGAAGGAAGTCGG - Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127314702 15:57783988-57784010 TGGGATCAGGAAATAGAAGCTGG + Intergenic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128128529 15:65210527-65210549 AAGGGTCAGGAGAGGAAAGCAGG + Intronic
1128240272 15:66096751-66096773 TAGGATCGGGAGCAGGGGGCAGG - Intronic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129559507 15:76551987-76552009 AAAGAACAGGAGAGGGAAGCTGG + Intronic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1129878273 15:78991192-78991214 TAGCATCAGATGAAGGAAGAGGG + Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1130688833 15:86062677-86062699 TGGGAGCAGGAGAAGGAAAGAGG - Intergenic
1130932463 15:88439383-88439405 CAGGATCAGGATAAGCAACCAGG - Intergenic
1131030623 15:89183588-89183610 AGGGATCAGGACAAGGATGCTGG - Intronic
1132549438 16:548304-548326 GAGGCTCAGGAGCAGGAAGAGGG - Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134288919 16:12887671-12887693 GGGGATCAAGGGAAGGAAGCGGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135597995 16:23757703-23757725 TAGGGCCAAGAGAAGAAAGCTGG + Exonic
1135867897 16:26121548-26121570 TTGGATCAGTAGCAGGATGCAGG + Intronic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136475484 16:30510540-30510562 TTGGCTCAGGAGAAGGGAGCAGG + Intronic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1140444280 16:75012288-75012310 AAGGATCATGAGATGGAAGGAGG + Intronic
1141583981 16:85020731-85020753 TAGCAACAGGTGAAGGACGCTGG + Intergenic
1141746171 16:85927892-85927914 TAGGATCAAGAAAGGGAAGGAGG + Intergenic
1141775767 16:86121772-86121794 TAGGAGGAGGTGAAGGAGGCAGG - Intergenic
1142108292 16:88317986-88318008 TGGGGCCAGGAGGAGGAAGCAGG - Intergenic
1144580527 17:16456490-16456512 GAGGAAGAGGAGGAGGAAGCTGG + Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145284473 17:21495110-21495132 TGGAGTCAGGAGAAGGGAGCGGG - Intergenic
1145392987 17:22470384-22470406 TGGAGTCAGGAGAAGGGAGCGGG + Intergenic
1145809550 17:27756258-27756280 TCTGACCAGGAGAAGGAAACGGG + Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1146926387 17:36748787-36748809 TTGTTTCTGGAGAAGGAAGCTGG - Intergenic
1147144408 17:38476988-38477010 TAGGGTCTGGAGAGGGAAGGAGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148212618 17:45817576-45817598 GAGGGGCAGGAGAAGGAATCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148785837 17:50145835-50145857 TTGGAGCAGGGGAGGGAAGCAGG + Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151051099 17:70979304-70979326 TAACAACAGGAGAAGGAAGAAGG - Intergenic
1151158541 17:72145037-72145059 TAGGAGGAGGAGAAAGAAGGAGG - Intergenic
1151441935 17:74135201-74135223 TAAGAGCAGGAGCAGGTAGCAGG + Intergenic
1151888104 17:76935120-76935142 AAGGATCAAGGGAATGAAGCAGG + Intronic
1152660137 17:81538242-81538264 TTGGAGCAGGTGGAGGAAGCTGG + Intergenic
1154527633 18:15309592-15309614 TAGTGTCGGGAGACGGAAGCTGG + Intergenic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1155713534 18:28911687-28911709 ACAGATCAGGAGAAGGAAGGAGG - Intergenic
1155959016 18:31978185-31978207 TAGGATCAGGGGCATTAAGCAGG + Intergenic
1156294569 18:35777673-35777695 AAGGGTCAGGAAAAAGAAGCAGG + Intergenic
1157314849 18:46578886-46578908 GAGGCTCAGGAGAATGAAGCAGG + Intronic
1157584428 18:48792092-48792114 AAGGCTGTGGAGAAGGAAGCAGG + Intronic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157924577 18:51749322-51749344 GGGGATATGGAGAAGGAAGCAGG + Intergenic
1158089924 18:53698978-53699000 TAACATCAGGAGAAGCAAGTTGG - Intergenic
1158861348 18:61595046-61595068 TAGGAAGAGGAGAAAGAAGGAGG + Intergenic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161632070 19:5362548-5362570 GAGGCTCAGGAGAGGAAAGCGGG + Intergenic
1161941365 19:7406596-7406618 TAGGTGCAGGGGAAGGCAGCTGG - Intronic
1161989038 19:7673504-7673526 AAGGATGAGGAGGAGGAAGGAGG - Intergenic
1162016038 19:7846968-7846990 TAGGGTCAGAGGAAGAAAGCAGG - Intronic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1163451344 19:17379165-17379187 GAGGAACAGGAGCAGGGAGCCGG + Intergenic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164567686 19:29339566-29339588 TAGGAGGAGGAGTAGGAAGAAGG + Intergenic
1164667915 19:30053631-30053653 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165974504 19:39663395-39663417 TAGCATCAAGAGAAAAAAGCAGG + Intergenic
1166143417 19:40818373-40818395 TAGGATGGGGAGAAGGGAGCTGG - Intronic
1166184135 19:41128405-41128427 TAGGATGGGGAGAAGGGAGCTGG + Intergenic
1166397938 19:42456163-42456185 TAGTGTGATGAGAAGGAAGCAGG - Intergenic
1166824422 19:45600337-45600359 GAGGGTCAGGAGACTGAAGCTGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167873375 19:52391454-52391476 GAAGAGCAGGAGAAGGAAGAAGG + Intergenic
1167935393 19:52902240-52902262 TAGTATTGGGAGACGGAAGCTGG + Intergenic
1168451676 19:56471163-56471185 TGGGAGCAGGAGAAAGAGGCAGG - Intronic
925167518 2:1727249-1727271 AAGGCTCAGGAGGAGGGAGCAGG - Intronic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926656321 2:15411033-15411055 AAAGAACAGGAGGAGGAAGCAGG - Intronic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927668228 2:25046899-25046921 TAGGATCTGGGGGAGGAGGCTGG - Intronic
927674077 2:25091611-25091633 TTGGATCTGCAGAAGGCAGCTGG + Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
928793571 2:34989135-34989157 TAGGATAAGGGGAAAAAAGCAGG - Intergenic
929250791 2:39752905-39752927 TAGGAGCAGGGGAAGGCAGAGGG - Intronic
929777829 2:44939470-44939492 AAGGGGCAGGAGGAGGAAGCGGG - Intergenic
930100074 2:47596574-47596596 TTGGATCAGGAGAATACAGCTGG - Intergenic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930687399 2:54324464-54324486 TGGCATCAGGAGAAGGCAGAGGG - Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933978589 2:87531714-87531736 GAGGAAGAGGAGAAGGAAGCAGG + Intergenic
935683976 2:105667718-105667740 TACCCTCAGGAGAAGGAAGGGGG - Intergenic
936019716 2:108985597-108985619 GAGGATCTGGGCAAGGAAGCAGG + Intronic
936146558 2:109984450-109984472 AAGGACCAGGAGCAAGAAGCTGG - Intergenic
936198132 2:110387029-110387051 AAGGACCAGGAGCAAGAAGCTGG + Intergenic
936315243 2:111419088-111419110 GAGGAAGAGGAGAAGGAAGCAGG - Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
937071830 2:119069658-119069680 TATGTCCAGGAGAAGGAAGGAGG + Intergenic
937505147 2:122528354-122528376 CAGGGACAGGAGAAAGAAGCTGG + Intergenic
938526727 2:132141049-132141071 TAGTGTCGGGAGACGGAAGCTGG + Intergenic
939669606 2:144993956-144993978 AAAGATCAAGAGGAGGAAGCTGG + Intergenic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940624163 2:156151153-156151175 TGGGAACAGGAAAAGGAAGACGG + Intergenic
940928832 2:159401929-159401951 TAGCATCTGGAGATGGGAGCAGG - Intronic
942243581 2:173986601-173986623 TAGGCTGAGAGGAAGGAAGCAGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942866347 2:180680025-180680047 TAGGAGGAGGAGGAGGAAGCAGG - Intergenic
943253722 2:185566064-185566086 TAGGATGAGGAGAAAGGAGAAGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946296205 2:218785588-218785610 TAGGATGAGGAAGAGGAAGCAGG + Intronic
946678173 2:222184677-222184699 TAGGATGAGGAGAAAATAGCAGG - Intergenic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947311330 2:228807161-228807183 TATGAACAGGAGAATTAAGCTGG + Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947962529 2:234251630-234251652 TCAGCTCAGGACAAGGAAGCTGG - Intergenic
948051001 2:234979263-234979285 GAGGATCGGGAGCTGGAAGCTGG - Intronic
948229742 2:236341363-236341385 TAGGAGGAGGAGAAAGGAGCGGG + Intronic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172178659 20:32987511-32987533 TAGGAGCAGGAGACAGATGCAGG - Intronic
1172837716 20:37883609-37883631 TAGCATCACGGGCAGGAAGCTGG + Intergenic
1172948146 20:38704205-38704227 TAGGAGCTGGAGAAGGCAGAAGG - Intergenic
1173092468 20:39986277-39986299 TAGAAACAGGAGAGGCAAGCGGG - Intergenic
1173559296 20:43991199-43991221 TAAGATAAGGACAAGGAACCAGG + Intronic
1174677474 20:52372463-52372485 GAGGTTCAGGAGAAGGATCCAGG - Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175366426 20:58459514-58459536 AGGGATCAGGAGGAGGAAGGAGG + Exonic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1177802945 21:25846374-25846396 TTGGAGCAGGAAAAGGAAGGAGG + Intergenic
1178377337 21:32077312-32077334 TAGGATCAGGGGGAGGGAGCCGG + Intergenic
1178433629 21:32537737-32537759 TAGGATCAGGAGAAGAAGGGAGG + Intergenic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1179082378 21:38183749-38183771 AAGGTTCAGTAGAAGGAAGTGGG + Intronic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179959576 21:44760549-44760571 TAGGAGCTGGAGACGGAAGCAGG + Intergenic
1180434697 22:15289081-15289103 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181375918 22:22457868-22457890 TTGCATCAGGAGACAGAAGCTGG - Intergenic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182919245 22:34064466-34064488 TATGATGAGGACCAGGAAGCAGG + Intergenic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1184997938 22:48223934-48223956 TAGCATCAGGACCAGGAAGCTGG - Intergenic
949708489 3:6846237-6846259 CAAGATCAGGAGAAGTAAGATGG + Intronic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950669684 3:14518565-14518587 GAGGATCAGATGGAGGAAGCAGG - Intronic
951417628 3:22444498-22444520 TAGGATAAAGAAAAAGAAGCTGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952266623 3:31793180-31793202 TGCCATCAGGAGAAGGAGGCAGG - Intronic
952970114 3:38645411-38645433 TAGGATTGGGAGAAGGGAGCTGG - Intronic
953030392 3:39176101-39176123 TTTCATCAGGAGAGGGAAGCTGG - Intergenic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
954586548 3:51741618-51741640 TGGCTTCAGGAGATGGAAGCTGG - Intergenic
954604853 3:51901343-51901365 TAGTATTGGGAGATGGAAGCTGG - Intronic
954996400 3:54885735-54885757 TAGGAACAGGAGAAAGAATGTGG + Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957989120 3:87608579-87608601 TGGCATCAGGAGACAGAAGCTGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961734560 3:128993433-128993455 TAGGAGCAGGCGGGGGAAGCAGG - Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963733194 3:148991888-148991910 AAGGACGAGGAGACGGAAGCAGG - Intronic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964129681 3:153272840-153272862 AAGGAGCTGGAGAAGGCAGCAGG + Intergenic
964374438 3:156035601-156035623 AAGGAGGAGGAGGAGGAAGCAGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966862267 3:184237074-184237096 TGGGGTCAGGAGAAGGAATGAGG - Intronic
966967706 3:185011766-185011788 TAGGATCAGTAGGAGGAAGAAGG + Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
969970054 4:11037609-11037631 TTGAATCAGAAGAGGGAAGCAGG + Intergenic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
971120930 4:23704177-23704199 GATGATCAGGTGAAGGCAGCTGG + Intergenic
972086123 4:35218870-35218892 TAGGCTGAGGAGAAGAAAGAGGG - Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972840200 4:42921870-42921892 GAGGATGAGGAAAAGGAAGGTGG - Intronic
973393300 4:49573877-49573899 TAGGATGAGGAGGAGTAGGCTGG + Intergenic
975948987 4:79745064-79745086 TAGGAAGAGGAGAAGGAAGTGGG - Intergenic
976192104 4:82497829-82497851 TAGGAGTAGGAGGAGGAAGTAGG + Intronic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978542748 4:109836467-109836489 TAGGATCATGAGCAGGAAAAGGG + Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978740934 4:112137165-112137187 CAGGATCTGGAGAAGTAAGGTGG - Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981569143 4:146132927-146132949 TAAGATCAGAGGATGGAAGCAGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
984220397 4:176967562-176967584 TAGGATCAGGGGAAGCATGAGGG + Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984944113 4:184957872-184957894 GAGGATCTGGAGAAGCAAGAAGG + Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
986501380 5:8403534-8403556 TGCAATCAGGAGAAAGAAGCAGG - Intergenic
986782454 5:11079289-11079311 GAGGCTCAGCAGAAGGGAGCTGG - Intronic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990628046 5:57636328-57636350 TAGGATGGGCAGAAGGACGCAGG + Intergenic
990943995 5:61231117-61231139 TGGGGTCAGGGGAAGGGAGCAGG - Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991499396 5:67261824-67261846 TGGGCTCAGGAGGAGGAAGAAGG + Intergenic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
992753945 5:79886736-79886758 GAGGATGAGGAGAAGAAATCTGG - Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996000956 5:118362960-118362982 TAGAACCAGGAGCAGGAAGTAGG - Intergenic
996441923 5:123500983-123501005 AGGGAACAGAAGAAGGAAGCTGG + Intergenic
997700901 5:135898747-135898769 TACGGTCAGGAAATGGAAGCTGG - Intergenic
997953443 5:138260025-138260047 TAGGATGAGGAGTAGAAAACAGG + Intronic
998092604 5:139380058-139380080 GATGATCAGGAGAATGGAGCTGG + Exonic
998261302 5:140633701-140633723 TAGGTTCAAGAAAAGGAAGTTGG + Exonic
998787273 5:145726605-145726627 TAGGACCAGGATCAGGAAGTTGG + Intronic
999656420 5:153815158-153815180 TAGGCTCAGGAGTAGCAAGCAGG + Intergenic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
999963243 5:156779662-156779684 TAGGTGCAGCAGTAGGAAGCAGG - Intergenic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002118228 5:176981706-176981728 TGGGACCAGGAGAAGGAAGGTGG + Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003510157 6:6772939-6772961 CAGGATCGGGAGAGAGAAGCCGG + Intergenic
1004952358 6:20687820-20687842 TTGGATCTAGAGAAAGAAGCAGG - Intronic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006102315 6:31693178-31693200 TAGGGTCAGGAGCAGCAAGCTGG + Intronic
1006392646 6:33767718-33767740 TGGGATGAGGAGATGGCAGCTGG + Intergenic
1006779229 6:36620817-36620839 GAGGGTCAGGTGAAGGAAGTTGG + Intergenic
1007735353 6:43978881-43978903 TAGCATCAGAAGAGGAAAGCAGG + Intergenic
1008891637 6:56499525-56499547 TAGGAGTAGGAGAAGAAAGCAGG + Intronic
1009463763 6:63945926-63945948 TAGGTTCAGGAAAAGGAATAAGG - Intronic
1009788533 6:68369486-68369508 TAGGATTAGGAGTGGGAAGGTGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011190772 6:84725943-84725965 TAGGACCAGGAGAAAAAAGCAGG + Intronic
1011436934 6:87348405-87348427 TAGCATCAGGAGAAGGGAAGTGG - Intronic
1012321101 6:97846983-97847005 GGGGATCAGGAGCAGGAAGTGGG + Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1014001484 6:116370802-116370824 GAGGATGAGGAGAGGGAAACGGG - Intronic
1014429132 6:121345626-121345648 TATGATCAGGAGCAGTAAGAAGG - Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015184125 6:130394193-130394215 TGGGTTCAGGAGAAGGATGTTGG - Intronic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016070514 6:139733063-139733085 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1016290618 6:142525132-142525154 TAGGAAAAGGAAAAGGAAGAAGG - Intergenic
1016827901 6:148405119-148405141 TAGGAAGAGGAAAAGGAAGAGGG - Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018392248 6:163349580-163349602 TAGGACCAGAGGAAGGAGGCAGG - Intergenic
1018803182 6:167238906-167238928 TGGGACCAGGACAAGGCAGCAGG - Intergenic
1019320796 7:414419-414441 GAGGATGAGGGGAAGGAAGGAGG - Intergenic
1019493202 7:1324571-1324593 TAGGGTTAGGAGCAAGAAGCGGG + Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1020343195 7:7134766-7134788 TAGGATGAGGAGGAGGATGTTGG + Intergenic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1021849296 7:24791896-24791918 TAGTGTTGGGAGAAGGAAGCTGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1023116849 7:36871233-36871255 TAAGATCAGGTGAAAGAGGCTGG + Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1024113386 7:46169839-46169861 TAGGATCAGCGGAGGGAAGGAGG + Intergenic
1024253586 7:47523697-47523719 CATTATCAGGAGAAGGAACCAGG - Intronic
1026071284 7:67122780-67122802 TAGGATGGGAAGAAGGATGCAGG - Intronic
1026284404 7:68950568-68950590 AGGGATCAGGAGAAGGACTCTGG - Intergenic
1026364039 7:69629581-69629603 TAGGATCTAGAGAAAGAATCAGG - Intronic
1026879717 7:73900792-73900814 GAGGAGCAGGAGAAGAAAGGGGG - Intergenic
1027856846 7:83522544-83522566 GGGGATCAGGACAAGGAAGGAGG - Intronic
1028086096 7:86639639-86639661 GAGGATGAGGATGAGGAAGCCGG - Intergenic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028759876 7:94483924-94483946 AAGGATTAGAAGAAGCAAGCCGG - Intergenic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032124932 7:129186886-129186908 CAGGAGCAGGAGGAAGAAGCGGG + Intergenic
1032417757 7:131750363-131750385 TTGGACCAGGAGAAGGAACTAGG + Intergenic
1032495010 7:132354927-132354949 TAAGACCAGTAGAAGAAAGCAGG - Intronic
1033529107 7:142245237-142245259 TGGGGTGAGGAGAAGGGAGCTGG + Intergenic
1033674424 7:143525159-143525181 GAGGATCATGAGAAGGAACGTGG - Intergenic
1033697412 7:143804288-143804310 GAGGATCATGAGAAGGAACGTGG + Intergenic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034835717 7:154350214-154350236 TAGGAAGGGGAGAAGGAAGCAGG + Intronic
1034859230 7:154581877-154581899 TAGCAGCAGGAGAAGGCAGGTGG - Intronic
1035158658 7:156934905-156934927 TAGGCTGAGGAGAAGAAATCCGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035857632 8:2993414-2993436 TAGGATCAGGAAAGTGATGCCGG - Intronic
1036104308 8:5823946-5823968 TAGTGTCAGGAGACGGAGGCTGG + Intergenic
1036227758 8:6974100-6974122 TAAGATCAAGAGAAAAAAGCGGG + Intergenic
1036230212 8:6993255-6993277 TAAGATCAAGAGAAAAAAGCGGG + Intergenic
1036232664 8:7012358-7012380 TAAGATCAAGAGAAAAAAGCGGG + Intronic
1037176772 8:15956656-15956678 TGGGTTCAGAAGAAGGAAGAGGG + Intergenic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1038287148 8:26215530-26215552 TTTGACCAAGAGAAGGAAGCAGG + Intergenic
1038429268 8:27486607-27486629 TGGGAGCAGGTGAAGGAAACAGG - Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042462540 8:69087153-69087175 TAGGATGAGGACCAGGGAGCTGG + Intergenic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1045295457 8:100868531-100868553 GAGGATGAGGAGAAGAAAGTGGG - Intergenic
1045322014 8:101089292-101089314 AAGGATTGGGAGAAGGAAGGAGG + Intergenic
1045555194 8:103208759-103208781 CAGGATCAAGAGCAGGCAGCAGG - Intronic
1045659057 8:104417498-104417520 TAGAGTCAGGAGAAGAAATCAGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047288944 8:123512356-123512378 TCATATCAGGAGAAGGTAGCAGG - Intronic
1047783161 8:128126358-128126380 TAGGAGCTGGAAAAGGAAGTGGG - Intergenic
1048574735 8:135681605-135681627 TAGGAACAGGAGGTGGAAGGAGG - Intergenic
1049007492 8:139864734-139864756 TAGGATCAGGACAATGACCCTGG - Intronic
1049306940 8:141908950-141908972 GAGGGACAGGAGGAGGAAGCTGG - Intergenic
1049725395 8:144143345-144143367 GAGTATCAGGCGGAGGAAGCTGG + Intergenic
1050115369 9:2257962-2257984 GAGGATCTGGAAAAGGAAACGGG + Intergenic
1052348023 9:27429609-27429631 TAGTGGCAGGAGGAGGAAGCTGG + Intronic
1052508146 9:29381241-29381263 TAGTATTGGGAGATGGAAGCTGG - Intergenic
1053662211 9:40291930-40291952 TAGGAGCAAGAGAAGAGAGCAGG - Intronic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054522399 9:66084354-66084376 TAGGAGCAAGAGAAGAGAGCAGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1057271606 9:93654693-93654715 TATGCTCAGGACAAGGGAGCAGG - Intronic
1058427395 9:104886736-104886758 TAGGATCAGGACTAGGCAGTGGG + Intronic
1058505596 9:105662784-105662806 TTGGACCAGGTGAAGGAACCTGG - Exonic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059565967 9:115383122-115383144 TAAGGTCAGGAGAAGAAAGAGGG + Intronic
1059928055 9:119231784-119231806 GAGGAACAAGAAAAGGAAGCTGG - Intronic
1059981379 9:119775887-119775909 GAGGAGCAGGAGAAAGAACCTGG - Intergenic
1061050584 9:128192417-128192439 TAGGTGCAGGATAAGGGAGCAGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062097767 9:134711776-134711798 TTGGATCAGGAGATGCAAGAAGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1186240313 X:7558485-7558507 AAGGATCAGGAGGAGAGAGCAGG - Intergenic
1187998952 X:24960127-24960149 TTAGATCAGGAGTTGGAAGCTGG - Intronic
1188840010 X:35005521-35005543 TAGGTTCAGCAAAAGGCAGCTGG - Intergenic
1192847996 X:74925490-74925512 TAGGAGGAGGAGGAGGAAGGGGG - Intergenic
1193102979 X:77636807-77636829 AAGGAGGAGGAGGAGGAAGCAGG + Intronic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1194959958 X:100223850-100223872 TAGGAATAGGAGGAGGAAGTTGG - Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196764621 X:119231713-119231735 GAGGATGAGGAGTAGGAAGAAGG + Intergenic
1197034020 X:121853535-121853557 TGGGCTGAAGAGAAGGAAGCTGG + Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198171822 X:134114362-134114384 AAGGAGCTGGTGAAGGAAGCAGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1200101160 X:153689564-153689586 CAAGGTCAGGAGAAGGATGCTGG + Intronic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic