ID: 1077866849

View in Genome Browser
Species Human (GRCh38)
Location 11:6229511-6229533
Sequence TACCTCAGTCAGCTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077866843_1077866849 15 Left 1077866843 11:6229473-6229495 CCTGCTCTGATGTGTCCATCCTT 0: 1
1: 0
2: 2
3: 24
4: 199
Right 1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 169
1077866845_1077866849 -4 Left 1077866845 11:6229492-6229514 CCTTATCGCCTCCCATGCATACC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 169
1077866844_1077866849 0 Left 1077866844 11:6229488-6229510 CCATCCTTATCGCCTCCCATGCA 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077866849 Original CRISPR TACCTCAGTCAGCTGAAGAA AGG Intronic
900416842 1:2539299-2539321 TACCTTAGTCAGATGAGAAATGG + Intergenic
900417034 1:2540089-2540111 TACCTTAGTCAGATGAGAAATGG - Intergenic
905419067 1:37826586-37826608 TACGTCTATCAGCTGAAGGAGGG + Intronic
905905398 1:41614771-41614793 TACAGCAGTCAGAGGAAGAAGGG + Intronic
908285918 1:62601155-62601177 TATTTCATTCAACTGAAGAAAGG - Exonic
908571598 1:65417147-65417169 TACCTCAGGAAGCTAAAGCATGG + Intergenic
909224048 1:72993625-72993647 TCCCTAAGTCAACTGAAGAATGG + Intergenic
909396286 1:75174284-75174306 AACCCCTGTCTGCTGAAGAAGGG + Intergenic
909996484 1:82286378-82286400 TAGCTGAGACAGCTGAAGGAAGG + Intergenic
910504098 1:87929468-87929490 TACCTGAGTAAGGTGAAGAAGGG + Intergenic
911642368 1:100302890-100302912 TTCCTCAGTCAGCTGGTGACTGG - Intergenic
912524126 1:110268205-110268227 TACCTGACTCAGCTGCACAAAGG + Intronic
912771217 1:112465604-112465626 GACCTCAGCCAGCTTGAGAAGGG + Intergenic
917118782 1:171627704-171627726 CTCCTCAGTCTGGTGAAGAATGG + Intergenic
918270264 1:182891533-182891555 TCCTTCCTTCAGCTGAAGAATGG + Intergenic
920948950 1:210554941-210554963 TACCTCTGTCTTCTGAAGGAAGG + Intronic
922411503 1:225380352-225380374 TACCTCACTCTCCTCAAGAAAGG + Intronic
923352635 1:233124388-233124410 TCCCTCACTGCGCTGAAGAATGG - Intronic
1065041039 10:21696480-21696502 TACTCCAGTCAGGTCAAGAATGG + Intronic
1068456704 10:57264481-57264503 TAACTCAGTGAGCTGGGGAAGGG + Intergenic
1070976882 10:80612577-80612599 TACCTCACAGAGCTGAGGAATGG + Intronic
1071985483 10:91046097-91046119 TACCACAGGGAGCTGAAAAAAGG + Intergenic
1072060007 10:91800251-91800273 AACCTAAATTAGCTGAAGAACGG - Intronic
1072276688 10:93830152-93830174 TGCCCCAGTCAGCTGAACATTGG + Intergenic
1076608209 10:131703020-131703042 AAGCTCAGTCACCTAAAGAACGG + Intergenic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1081489385 11:43555686-43555708 TACCGCAGTCAGCTCAAGCAGGG + Intergenic
1085010049 11:73133366-73133388 TATCTCTGTCAACTGATGAAGGG + Intronic
1086955778 11:92933440-92933462 TACCTCACACAGCTGGAGGAGGG + Intergenic
1091670538 12:2449170-2449192 TCCTTAAGTCAGCTGAAGACAGG + Intronic
1092064159 12:5575882-5575904 AACGTCAGCCAGCTGAAGGAGGG - Exonic
1092306866 12:7310424-7310446 TAGCTGAGGTAGCTGAAGAATGG + Intronic
1093519913 12:20036744-20036766 TGCCTTAGTCACCTGAAGAAAGG - Intergenic
1093866743 12:24236550-24236572 TACATCAGTCAGCCCAAGACTGG - Intergenic
1096520247 12:52180900-52180922 TACCTTCTTCAGCTGAACAAAGG + Exonic
1097156532 12:57016114-57016136 TTCCTCAGTCAGCTGGAGGAGGG + Intronic
1097612664 12:61843839-61843861 TAACACATTCAGCTGAAGACTGG + Intronic
1103793464 12:123487669-123487691 GATGTCCGTCAGCTGAAGAATGG - Intronic
1104682214 12:130759931-130759953 TCACCCAGTCAGCTGAAGGAAGG - Intergenic
1104760606 12:131295649-131295671 TTCCTCAGTCAGATGGAGGAGGG - Intergenic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1105945536 13:25186524-25186546 CACCTGTGTCAGCTGCAGAAAGG - Intergenic
1108637512 13:52350642-52350664 AAATTCTGTCAGCTGAAGAATGG - Intergenic
1108734705 13:53270577-53270599 TACCACAGCCAGCAGATGAAGGG + Intergenic
1111770417 13:92589076-92589098 TACTTCACTGAGTTGAAGAATGG - Intronic
1113029950 13:105982360-105982382 TACCCCAGTCAGCTGCAGCAGGG - Intergenic
1113630557 13:111880265-111880287 TCCCGCAGTCAGCTGGAGCAGGG + Intergenic
1113792527 13:113036697-113036719 TATCGCAGACACCTGAAGAAAGG - Intronic
1115612342 14:35060905-35060927 TACCTCCTTCATCAGAAGAAGGG + Intronic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1117362282 14:54987984-54988006 TACTATAATCAGCTGAAGAAGGG + Intronic
1118362472 14:65068041-65068063 TACCTCAGCCAGGCGATGAAGGG - Intronic
1118637604 14:67762267-67762289 GACCTCAATCAGCTGAATCATGG - Exonic
1121109796 14:91304292-91304314 CACCACAGTCAGCTGAAAAGAGG - Intronic
1124689474 15:31810104-31810126 TTCTTCAGGCAGCTGGAGAAGGG + Intronic
1129005464 15:72369363-72369385 CAACAAAGTCAGCTGAAGAAAGG - Intronic
1131129318 15:89885825-89885847 TACCTCAGTCTCCTGAGTAATGG - Intronic
1132178915 15:99736715-99736737 TACCTAAGTCATATGGAGAAGGG + Intergenic
1133110825 16:3547145-3547167 AACGTCCGTCAGCTGATGAATGG + Intronic
1133208570 16:4249351-4249373 TAAATCTGGCAGCTGAAGAAAGG - Intergenic
1133751571 16:8730051-8730073 TACCTCAGTTGCCTGAAGACAGG + Intronic
1135863139 16:26075664-26075686 TACCCCAGCCAGCTGAGAAAAGG - Intronic
1138393193 16:56684790-56684812 TGCCTCATTCATCTGAAGGATGG + Intronic
1141740654 16:85889947-85889969 TACCTCAGTCCACTTAATAATGG - Intergenic
1142259521 16:89036269-89036291 TCCCTCAGTCAGCTGAATGGTGG - Intergenic
1142484901 17:240680-240702 TACGTCCATCAGCTGATGAATGG - Intronic
1143017965 17:3901520-3901542 TACCCAAGTCAGCTGTGGAAGGG - Intronic
1143945378 17:10587140-10587162 TACCTCAGCCAGGTGATCAAAGG - Intergenic
1144436990 17:15251101-15251123 GCCCTGAGTTAGCTGAAGAAAGG - Intronic
1150970144 17:70018528-70018550 TACTTGTTTCAGCTGAAGAAAGG + Intergenic
1152200847 17:78945013-78945035 TCCCTCAGGCAGCTGAAGCCAGG - Intergenic
1155398054 18:25407197-25407219 TACCTCAGCCAGGTGATAAAGGG - Intergenic
1155761380 18:29572286-29572308 TACCTAAGGTAACTGAAGAAAGG + Intergenic
1156614352 18:38765912-38765934 TACCTAAATCATATGAAGAAGGG + Intergenic
1156661531 18:39351588-39351610 GACTTCTGTCAACTGAAGAATGG - Intergenic
1158945742 18:62445620-62445642 TACCTCAGACAGATGACTAATGG - Intergenic
1165551190 19:36587608-36587630 AACATCCGTCAGCTGATGAATGG + Intronic
1165592286 19:36979430-36979452 TACCTCTGACAGCTAAAGAAGGG - Intronic
1166399281 19:42466113-42466135 CACCTCAGTCTGCTCAAGAGTGG + Intergenic
1166563474 19:43748678-43748700 ACCCTCAGTCTGCTGAAGAGGGG + Intronic
925862411 2:8192608-8192630 TACCTCATTAAGCAGAAGCAGGG + Intergenic
926998598 2:18768130-18768152 TAAATCAGTCAGGAGAAGAAAGG + Intergenic
931798564 2:65736071-65736093 TCCCACAGTTAGGTGAAGAATGG - Intergenic
933907555 2:86910256-86910278 TACCTCACTCAGATGGAAAACGG - Intronic
936284441 2:111171443-111171465 TACCTCAGGCAGGGAAAGAAAGG - Intergenic
947174984 2:227356751-227356773 TAACTCAGAAATCTGAAGAAGGG + Intronic
947770737 2:232668304-232668326 TACCCCAGCCAGTTAAAGAAGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169601638 20:7267779-7267801 TACCTCAGGCACCTTTAGAAGGG + Intergenic
1170333173 20:15237813-15237835 GTCCTCAGCCAGCTGATGAAGGG - Intronic
1171101081 20:22384489-22384511 TACCTCGGTGATCTGAAAAATGG - Intergenic
1174300551 20:49579177-49579199 TACCTTATTCAGCTTCAGAATGG - Intergenic
1176305678 21:5121884-5121906 ACCCTCAGTCAGCTGCAGCAAGG + Intronic
1179851379 21:44140147-44140169 ACCCTCAGTCAGCTGCAGCAAGG - Intronic
1180142897 21:45903082-45903104 TACCTCAGACATCTTAGGAATGG - Intronic
1181869263 22:25885288-25885310 TACATCACTCAGCTGGTGAATGG + Intronic
1182789082 22:32933773-32933795 TGCCTCATTCAGCTGAACAGTGG - Intronic
1185205946 22:49538807-49538829 TACCACAGTCACCTGGAGAAAGG - Intronic
949471560 3:4401898-4401920 TACTTCAGTGTGCTCAAGAAAGG - Intronic
949854337 3:8446695-8446717 TACATCTATCAGCTGATGAATGG - Intergenic
950285638 3:11742698-11742720 TACCTCAGTCTCCTGAATAGCGG + Intergenic
950507414 3:13403862-13403884 GAGCTCAGCCAGCTGAAGAGGGG - Intronic
952937768 3:38413543-38413565 CACCTCAGACAGCTGAAACAAGG - Exonic
953154484 3:40356739-40356761 GACCAGAGTCAGCTGGAGAAGGG - Intergenic
953487647 3:43317397-43317419 TACCTCAGTCTGCTGACCCAAGG - Intronic
955813064 3:62811650-62811672 TTGCTCAGGCAGCTGAACAATGG + Intronic
956632296 3:71328636-71328658 TACCCTGGTCAGCTGTAGAAAGG - Intronic
959461146 3:106627538-106627560 TACCTGAGGAAGGTGAAGAAGGG + Intergenic
965973949 3:174597601-174597623 TACCTCATTCAGCTGCAATATGG - Intronic
967330633 3:188285987-188286009 TACCTCAGCCACCAGAAGAAGGG - Intronic
967947766 3:194817772-194817794 TACCTCAGACAGGAGAAGAGGGG + Intergenic
969961269 4:10946965-10946987 TATCTCAGTGAGCAGAGGAATGG - Intergenic
974031769 4:56782790-56782812 TACCTCAGTCACCTGAGTAGCGG + Intergenic
974237704 4:59203689-59203711 TACACCAGTCAGTGGAAGAAGGG + Intergenic
974262324 4:59541967-59541989 TTCCTCTGTCAGCTGATAAAGGG + Intergenic
974592535 4:63972403-63972425 AACCTGAGTCAGCTGCATAATGG + Intergenic
975017945 4:69447309-69447331 TACCTCAGGTGGCTGATGAAAGG + Intergenic
975890915 4:79026087-79026109 TACCTCTGTCATCTGTACAATGG - Intergenic
976868631 4:89762788-89762810 TACCTCTGAAAGCTGCAGAATGG - Intronic
978581584 4:110236877-110236899 TACTTCAGTAGGCTGAATAATGG - Intergenic
979029111 4:115617755-115617777 TGCCTCAGTGTGCTGAAAAAAGG + Intergenic
981138426 4:141238938-141238960 TACCTCCTTCTGATGAAGAAAGG - Intergenic
981291981 4:143086870-143086892 TACCTTATTCAGCAAAAGAAAGG + Intergenic
983055954 4:163098999-163099021 TACCTCTGTCAGCTGATGGGTGG - Intergenic
987468147 5:18296674-18296696 TTCCTCTGTCAACTGATGAAAGG + Intergenic
989104909 5:37853345-37853367 TAGCTTAGTGATCTGAAGAAAGG + Intergenic
990238758 5:53796238-53796260 TCCCTCTTTCAGCTGTAGAAGGG + Intergenic
990973874 5:61540441-61540463 TACCCCAGTTACCTAAAGAATGG + Intronic
992282383 5:75194147-75194169 TATGTAAGTAAGCTGAAGAAAGG - Intronic
993549565 5:89256910-89256932 TTCCTCAGCCTTCTGAAGAAAGG - Intergenic
993896704 5:93543797-93543819 TACATAAGTCAGCTGAAGTGAGG - Intergenic
994178084 5:96733989-96734011 TATTTCAATCAGATGAAGAAAGG + Intronic
995390267 5:111632976-111632998 TACCTACGTCCTCTGAAGAAGGG + Intergenic
999675700 5:153999878-153999900 AACCTAAGTCAGTTGAAAAATGG + Intronic
1002976770 6:2086547-2086569 TCCCCGAGTCAGCTGCAGAACGG - Intronic
1004272125 6:14204890-14204912 CACCTCAGGCAGCTGACAAAGGG + Intergenic
1005266984 6:24122423-24122445 TCCTTCATTCAGCTGATGAAAGG - Intergenic
1006063095 6:31440462-31440484 TACATCAGTCAGCTGGATGAAGG + Intergenic
1006183575 6:32168080-32168102 AACTTCAGAGAGCTGAAGAAAGG + Exonic
1008709493 6:54207540-54207562 TACATAAGGCAGCTGAAGAGGGG - Intronic
1011095352 6:83655871-83655893 TTCCTCAGTCAGCTGGTGATAGG - Intronic
1011370615 6:86633434-86633456 AACCTCTGTCAGCTGGAGACTGG + Intergenic
1011786318 6:90849222-90849244 TACATCAGTCAGAAGAAGGATGG + Intergenic
1017667254 6:156732230-156732252 TTCCCCAATCAGCTCAAGAAAGG - Intergenic
1019196721 6:170287446-170287468 GGCCTCAGTCAGCTGGAGAGAGG + Intronic
1021942575 7:25693371-25693393 TACTTCAGTGTGCAGAAGAAGGG + Intergenic
1023615436 7:42014962-42014984 AAACTCACTCAACTGAAGAATGG - Intronic
1026076086 7:67169763-67169785 AACGTCCATCAGCTGAAGAACGG - Intronic
1026700772 7:72642534-72642556 AACGTCCATCAGCTGAAGAACGG + Intronic
1027208350 7:76122649-76122671 TACCTCAGTAAGCCAAAGAGAGG + Intergenic
1027540451 7:79457700-79457722 TACTGCAGTCAGCAGAATAATGG - Intergenic
1030078053 7:105753634-105753656 TACAGCAGACAGCTGAAGACAGG + Intronic
1033385752 7:140873503-140873525 TTGGTCAGTCATCTGAAGAAGGG - Intronic
1034353572 7:150433176-150433198 AACCTCAGGCAGCTGGAGGATGG + Intergenic
1035063918 7:156091761-156091783 GACCTCAGCCAGCAGAAGATGGG + Intergenic
1037111640 8:15169544-15169566 TTCCTTAGTCAGCTAAAGACAGG - Intronic
1038991205 8:32870285-32870307 TACCTCAGTCACATGCACAAGGG + Intergenic
1039376383 8:37038504-37038526 TAACTCATACAGATGAAGAATGG + Intergenic
1039771117 8:40687957-40687979 GTCCTCAGTCATCTGAAGGAAGG - Intronic
1041008970 8:53523081-53523103 TGCTTCAGGGAGCTGAAGAAAGG - Intergenic
1042227015 8:66522101-66522123 TGACTCAGGCAGCTGAAGACAGG + Intergenic
1042481767 8:69312613-69312635 TAGATCATTCAGCTGAAGTATGG - Intergenic
1044268803 8:90215524-90215546 CACCTCAGACAGGAGAAGAAGGG - Intergenic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1045489053 8:102655563-102655585 TACCGCAGTCTGCTGGAGAGAGG + Exonic
1046083299 8:109399317-109399339 AACCAAATTCAGCTGAAGAAGGG + Intronic
1051416858 9:16850685-16850707 TACCTCAGGAAGCTGAGGTAGGG + Intronic
1051563387 9:18468755-18468777 GACCCCAGTCAGTAGAAGAAAGG - Intergenic
1051710848 9:19928972-19928994 CACCTCAGTCAGCTAGGGAAGGG - Intergenic
1057605250 9:96494294-96494316 TACCTCAGGCAGGGGATGAAAGG + Intronic
1058433125 9:104936793-104936815 GACGTCAGTCACCAGAAGAATGG - Intergenic
1059707147 9:116836086-116836108 TACCTCATCCAGCTGAAAAGAGG - Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1186637256 X:11419775-11419797 TATTTCAGTCAACTGCAGAAAGG + Intronic
1186713388 X:12224680-12224702 TCTCTCAGTAAGCAGAAGAATGG + Intronic
1186920110 X:14269495-14269517 TGTCTCAGTCAGCTGAAGCATGG - Intergenic
1188278710 X:28236158-28236180 TACCTCAGGCAAGAGAAGAAAGG - Intergenic
1192321031 X:70091030-70091052 TATCTCTGACAGCTGAAGTATGG - Intergenic
1195722009 X:107876677-107876699 TCCCTCTGTCAGCTGCAGAATGG + Intronic
1196030849 X:111094633-111094655 CATCTCAGGCAGTTGAAGAATGG - Intronic
1197159355 X:123306623-123306645 AGCCTCAGCCAGCTGAAGATAGG + Intronic
1198979332 X:142377258-142377280 AACCTCAGTCATCTCAAAAAAGG + Intergenic