ID: 1077872330

View in Genome Browser
Species Human (GRCh38)
Location 11:6272321-6272343
Sequence CTGTGAATGGGGATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077872324_1077872330 0 Left 1077872324 11:6272298-6272320 CCTACATTCCAATGTTGCAATAA 0: 1
1: 0
2: 1
3: 23
4: 349
Right 1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG 0: 1
1: 0
2: 4
3: 58
4: 560
1077872325_1077872330 -8 Left 1077872325 11:6272306-6272328 CCAATGTTGCAATAACTGTGAAT 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG 0: 1
1: 0
2: 4
3: 58
4: 560
1077872323_1077872330 6 Left 1077872323 11:6272292-6272314 CCTCTACCTACATTCCAATGTTG 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG 0: 1
1: 0
2: 4
3: 58
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077872330 Original CRISPR CTGTGAATGGGGATGGAAAA TGG Intergenic
900002076 1:19969-19991 CTGAGACTGGGGAGGGACAAAGG + Intergenic
900021797 1:190492-190514 CTGAGACTGGGGAGGGACAAAGG + Intergenic
901463639 1:9406609-9406631 CTATGAATGGGCTTGGAAGAGGG - Intergenic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
903853025 1:26319621-26319643 CTGTGAAAGGGGGTGGACAGGGG + Intronic
904087338 1:27918261-27918283 CTGTTACTGGGAATGTAAAATGG + Intergenic
904180633 1:28664287-28664309 CTGAGAATGTGGATGCAGAAGGG + Intergenic
904289390 1:29474471-29474493 CAGTGAATGGGGAAGGCACACGG - Intergenic
904428751 1:30448304-30448326 CAATGAATGGGTATGGAAACAGG - Intergenic
904439986 1:30524022-30524044 GAGTGAATGGGGAAGGAAAGGGG + Intergenic
905002938 1:34687649-34687671 CTGTAGGTGGGAATGGAAAATGG - Intergenic
905714661 1:40138271-40138293 CTGTTGATGGGAATGAAAAATGG + Intergenic
906358877 1:45135175-45135197 CTGTGAGTGGGAATGTAAAATGG - Intronic
906805738 1:48777134-48777156 ATTCGAATGGGGAGGGAAAAGGG + Intronic
907697994 1:56753404-56753426 ATGGGAATGGGGATGGTAATTGG + Intronic
907820678 1:57964874-57964896 CAGTGAACTGGGATGGAATAAGG + Intronic
909440748 1:75692939-75692961 CTGAGAATAGTGAAGGAAAAAGG + Intergenic
909761938 1:79299887-79299909 CTGTCAATGGGAATGTAAATTGG - Intergenic
909930981 1:81500195-81500217 CTGTTAGTGGGGATGTAAAATGG + Intronic
910537047 1:88310279-88310301 CTGTGAACTGGGATGGTTAATGG - Intergenic
910624574 1:89292851-89292873 CTCTCAATGTGGATGGAGAAAGG - Intergenic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
911863719 1:102989714-102989736 CTGTGGCTGGAGTTGGAAAAGGG - Intronic
914333507 1:146694741-146694763 CTGTTACTGGGAATGCAAAATGG - Intergenic
914560690 1:148816381-148816403 CTGTTGATGGGAATGTAAAATGG - Intronic
914612144 1:149313834-149313856 CTGTTGATGGGAATGTAAAATGG + Intergenic
915382004 1:155450591-155450613 CTGTTGATGGGAATGTAAAATGG + Intronic
915839409 1:159202694-159202716 CTGACAATGGGCATGCAAAAAGG + Intronic
916918247 1:169434324-169434346 CTGTTAGTGGGAATGTAAAATGG + Intronic
917451582 1:175151771-175151793 TTGTGATTGAGGAAGGAAAAAGG + Intergenic
917597975 1:176548816-176548838 TTGTAAATGGGGATGAAAATGGG + Intronic
918133071 1:181646025-181646047 CAGTGAGTGGGGAAGGAAAGAGG - Intronic
918874505 1:190022298-190022320 CTGTTAATGGGAATACAAAATGG + Intergenic
919134970 1:193496518-193496540 CTGGGAATGGGGGTAGAAAGGGG - Intergenic
920426153 1:205877481-205877503 TTGTGTATGGGGAGAGAAAAGGG + Intergenic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
920862122 1:209718618-209718640 CTGTTGATGGGAATGTAAAATGG + Intronic
920923880 1:210323259-210323281 CTGTTGATGGGAATGTAAAATGG + Intergenic
922369838 1:224898314-224898336 GAGAGAATGGGGATGGTAAATGG - Intronic
922795951 1:228339919-228339941 CTGTGAAGGGGGATGGCATCAGG - Intronic
922997770 1:229979969-229979991 GTGGGAATGGGAATGTAAAATGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
923757660 1:236807481-236807503 CTGTTAGTGGGAATGTAAAATGG - Intronic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924488044 1:244506493-244506515 CTGTTAATGGGAATGTAAGATGG - Intronic
1062886489 10:1020593-1020615 CTGTGAATGGGGCTGTGAATGGG - Intronic
1063234099 10:4094354-4094376 CTGTCCATGGGAATGGAAAATGG + Intergenic
1064415367 10:15144792-15144814 CTGTTGATGGGAATGTAAAATGG + Intronic
1065345841 10:24747413-24747435 CTCTGAGGGGGGAAGGAAAAGGG + Intergenic
1065486870 10:26244274-26244296 CTGAGAGTGGGAATGTAAAATGG + Intronic
1065810035 10:29433857-29433879 GTGGGAATGGGGATGGTTAATGG - Intergenic
1067170482 10:43902255-43902277 CTGTGAGGGAGGCTGGAAAATGG - Intergenic
1067411933 10:46072326-46072348 TTGTTAATGGGAATGTAAAATGG + Intergenic
1068345999 10:55778862-55778884 CTGTAAATTGGGATGTAAATTGG - Intergenic
1068737710 10:60432953-60432975 CTTTGGCTGAGGATGGAAAAAGG - Intronic
1069332663 10:67311460-67311482 CTGTGGCTGGGGATTGAGAAGGG + Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069573639 10:69509203-69509225 CTGTGAGTGGTGCTGGAAAGAGG - Intergenic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1070233407 10:74596099-74596121 TTGTGAATGTGGTAGGAAAATGG + Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070993630 10:80755421-80755443 CTCAGAATTGGGAAGGAAAAGGG + Intergenic
1070995274 10:80773441-80773463 CTGCTAGTGGGGATGTAAAATGG - Intergenic
1071514969 10:86291269-86291291 AGGTCAATGGGGATGGAAAGTGG - Intronic
1073056624 10:100707371-100707393 GCGTGAGTGGGGGTGGAAAATGG - Intergenic
1073322939 10:102626584-102626606 CTGTGAATGGGAATGGAAGTTGG + Intronic
1074304089 10:112260516-112260538 CTGTTGGTGGGAATGGAAAATGG + Intergenic
1074416155 10:113268694-113268716 CTGGCAATGGGGAGTGAAAATGG + Intergenic
1074435765 10:113432913-113432935 CTGTGAATGGGAATAGTAAAAGG + Intergenic
1074435936 10:113434376-113434398 CTGTGAGTGGGAATAGTAAATGG + Intergenic
1075154610 10:119964279-119964301 ATGTGAGTGGGCTTGGAAAAAGG - Intergenic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1075594585 10:123719370-123719392 CTGCGGATGGGAATGTAAAATGG - Intronic
1076263448 10:129090522-129090544 TTCTGAATGGAGATGGGAAAAGG + Intergenic
1077449142 11:2625176-2625198 CTGTTAGTGGGAATGCAAAATGG - Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079881181 11:25929063-25929085 CTGATATTGGGGATGGATAAAGG - Intergenic
1079949894 11:26788594-26788616 TTGGGAAGGGGGATGGAAAGGGG + Intergenic
1080799761 11:35599305-35599327 CTGCACATGGGGATGGAAAACGG + Intergenic
1081127266 11:39337022-39337044 ATGTTAATGGGAATGTAAAATGG - Intergenic
1081501574 11:43671819-43671841 CTGTTAGTGGGAATAGAAAATGG + Intronic
1081769560 11:45640459-45640481 CTGGGAATGGGGAAAGGAAACGG + Intergenic
1082738029 11:56878215-56878237 TTGTTAATGGGAATGTAAAATGG - Intergenic
1083083053 11:60113471-60113493 CAGGGATGGGGGATGGAAAAGGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1084627276 11:70318090-70318112 AGGTGAATGGGCATGGAGAACGG - Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085688383 11:78646427-78646449 CTGTGCCTGAGGTTGGAAAAAGG - Intergenic
1086494145 11:87385121-87385143 CTCTGCATGGGGATGGGAGAGGG - Intergenic
1086996487 11:93362592-93362614 TTGTGAATGGGAATGGAAAATGG + Intronic
1087090281 11:94263311-94263333 CTGTTGATGGGAATGCAAAATGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1089215659 11:116833096-116833118 CTGTGTCTGGGCATGGGAAAGGG + Intergenic
1089345539 11:117789053-117789075 CTTTGCATGGGGATTGGAAATGG - Intronic
1089393762 11:118120413-118120435 CTGTTGATGGGAATGTAAAATGG - Intronic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1089459077 11:118642225-118642247 GTGGGAATGGGGAGGGGAAAAGG - Intronic
1089758663 11:120706753-120706775 CTGTGAGTAGGGATGGCAACTGG + Intronic
1090299931 11:125626312-125626334 CTGTGGATGGGGATGGGAATTGG + Intronic
1091375140 12:20004-20026 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1092993381 12:13924913-13924935 CTGTGACTGGGCATGGATAGTGG - Intronic
1093096020 12:14973204-14973226 CTGTGGCTGGGGATGAAAATGGG + Intronic
1093720365 12:22435848-22435870 TTGTGAGTGGGAATGCAAAATGG + Intronic
1093891265 12:24524709-24524731 CTGTTGATGGGAATGCAAAATGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094078728 12:26508801-26508823 CTGCTAATGGGAATAGAAAATGG + Intronic
1095426868 12:42084250-42084272 GTAAGAATGGGGATGGCAAAGGG - Exonic
1095660197 12:44723707-44723729 CTGTAAATGTGGATGAAAACAGG - Intronic
1096094015 12:48922758-48922780 CTGGGAATGGGGAGGTAATAGGG + Intronic
1096488834 12:52002542-52002564 ATGTGAATGGTGAGGGAAAGAGG + Intergenic
1096750259 12:53754105-53754127 GTGGGGATGGGGATGGATAATGG + Intergenic
1096829049 12:54300552-54300574 CTGTGAATGGGGATCAGAGAGGG - Intronic
1096878830 12:54650807-54650829 CTGTTAATCAGAATGGAAAATGG - Intergenic
1097055703 12:56247945-56247967 ATGGGAATGGGGCTGGAAAGTGG - Intronic
1097221523 12:57454106-57454128 CTGTTAATGGGGGTAGAAAATGG - Intronic
1098508745 12:71285864-71285886 CTGTTGATGGGAATGTAAAATGG - Intronic
1100335816 12:93628256-93628278 CTGTTAATGGGAATGTAAAATGG - Intergenic
1100427981 12:94505048-94505070 CTGCTAATGGGAATGTAAAATGG + Intergenic
1100432654 12:94544390-94544412 CTGTTGGTGGGAATGGAAAACGG + Intergenic
1100894437 12:99163882-99163904 CTATTAATGGGAATGTAAAATGG - Intronic
1100935856 12:99665212-99665234 CAATGAATGGGAATGTAAAATGG - Intronic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1102049984 12:109855420-109855442 CTGTGAATGGGGCTGGCCAAGGG + Intronic
1102326798 12:111992758-111992780 GTGGGAATGGGGATGCCAAAAGG - Intronic
1102699078 12:114823599-114823621 CTGTGAATGGGGGTGTTACATGG + Intergenic
1103793817 12:123490030-123490052 AGGAGAAAGGGGATGGAAAAGGG - Intronic
1104606055 12:130188619-130188641 CTGTTAATTGGCATGGAATAAGG - Intergenic
1105049487 12:133035994-133036016 AGGTGAATGGTGAAGGAAAAAGG - Intergenic
1105415151 13:20205547-20205569 CTGTTCATGGGGAGGGAACAGGG - Intergenic
1105823600 13:24102079-24102101 CTGTTAGTGGGAATGTAAAATGG - Intronic
1106616279 13:31331561-31331583 CTGGGAATGGGGAGGGGAAATGG + Exonic
1107044650 13:35981888-35981910 CTGTTGATGGGAATGCAAAATGG - Intronic
1107669631 13:42731507-42731529 GTGTGAATGAGGAAGGAAAAAGG + Intergenic
1107767438 13:43751978-43752000 CTGTTAGTGGGAATGTAAAATGG - Intronic
1108068093 13:46599447-46599469 CTGTGGGTGGGAATGTAAAATGG - Intronic
1109223743 13:59667748-59667770 CCTTGAATGGGGCTTGAAAATGG + Intronic
1109793919 13:67285306-67285328 CTATGAATGGGGATGCAATGTGG - Intergenic
1110101173 13:71605751-71605773 CTCTGCATGGGGAAAGAAAAAGG - Intronic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1111143651 13:84154538-84154560 CTTTGCATGGGGATGGGGAATGG + Intergenic
1112370574 13:98789579-98789601 CTGCCGATGGGAATGGAAAATGG - Intergenic
1112552330 13:100433221-100433243 CTGCTAATGGGAATGTAAAATGG - Intronic
1112588305 13:100739324-100739346 CTGTTGGTGGGGATGTAAAACGG + Intergenic
1113703772 13:112410693-112410715 CTGTTGATGGGAATGTAAAATGG + Intronic
1114471562 14:22966606-22966628 CTATGAAAGGGGGTGGAAGAAGG + Intronic
1114703507 14:24703208-24703230 CTGTTAGTGGGAATGTAAAATGG - Intergenic
1114858850 14:26490441-26490463 CTGTTGTTGGGGATGTAAAATGG - Intronic
1114915675 14:27261952-27261974 CTGTTGATGGGAATAGAAAATGG + Intergenic
1115189108 14:30727816-30727838 ATGTGACTGGGAATGGACAAAGG - Intronic
1115872093 14:37816272-37816294 CTGTTATTGGGGGTGGAAGAGGG - Intronic
1115892241 14:38044311-38044333 CTGTGAAGGTGAAAGGAAAATGG + Intergenic
1116548695 14:46206028-46206050 CTGTTGGTGGGGATGCAAAATGG + Intergenic
1116751060 14:48884315-48884337 CTGCTAGTGGGGATGTAAAATGG - Intergenic
1116853827 14:49934228-49934250 CTGTTGATGGGAATGTAAAATGG - Intergenic
1116996576 14:51330950-51330972 CTCTGATTGGGGATGAGAAAAGG - Intergenic
1117025558 14:51616436-51616458 CTGTGGAGGGGAATGGACAAGGG + Intronic
1117087974 14:52220837-52220859 CTGGAAAAGGGGATGCAAAAAGG + Intergenic
1117381765 14:55171512-55171534 CTGTTGATGGGAATGTAAAACGG + Intronic
1117586912 14:57217150-57217172 CTGTTGATGGGGATGTAAATTGG + Intronic
1117642493 14:57814763-57814785 CTGGGTATGGCGATGGAATAGGG + Intronic
1117660701 14:58001502-58001524 CTGTGGGTGGGAATGTAAAATGG - Exonic
1118728093 14:68644653-68644675 CTGTGAGGGGAGATTGAAAACGG - Intronic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1122672207 14:103381409-103381431 CTGTTGGTGGGGATGTAAAATGG - Intergenic
1123463029 15:20492107-20492129 CGGTGCAGAGGGATGGAAAAAGG - Intergenic
1123655030 15:22508307-22508329 CAGTGCAGAGGGATGGAAAAAGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1124105627 15:26735282-26735304 CTGTTGATGGGAATGTAAAATGG + Intronic
1124273868 15:28309510-28309532 CGGTGCGGGGGGATGGAAAAAGG - Intronic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124622793 15:31285796-31285818 CTGCTAGTGGGGATGTAAAATGG + Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124913156 15:33943002-33943024 CTGTTACTGGGGCTGTAAAATGG + Intronic
1125737476 15:41937235-41937257 CTGTGCATGTGGCTGGAACATGG - Intronic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1126238091 15:46409098-46409120 TGGAGAAAGGGGATGGAAAAAGG - Intergenic
1126790094 15:52213002-52213024 CTGTGAATGGGGAGTAACAAAGG - Intronic
1128167236 15:65476549-65476571 CTGTTAGTGGGAATGTAAAATGG + Intronic
1128442568 15:67725936-67725958 CTATGTACGGGGAGGGAAAAGGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1128909539 15:71500080-71500102 CTGTTAGTGGGAATGTAAAATGG - Intronic
1129854670 15:78814742-78814764 CTGTCAACGGGGATGGCAAAGGG - Intronic
1130063902 15:80589362-80589384 CTGTAAATGTTGATGGCAAAGGG + Intronic
1130644417 15:85711347-85711369 CAGGGAATGGGGAGTGAAAAGGG - Intronic
1131279561 15:91009630-91009652 CTGAGAATGGGAATGGGAATAGG - Intronic
1131670138 15:94611004-94611026 CTGGGAAAGGGGGTGAAAAATGG + Intergenic
1131867548 15:96728143-96728165 TTGTGCATGGGAATAGAAAATGG - Intergenic
1132451436 15:101970970-101970992 CTGAGACTGGGGAGGGACAAAGG - Intergenic
1132508318 16:323911-323933 CTGCGACAGGGGATGGAATACGG + Intronic
1133530590 16:6651599-6651621 CTGTTAGTGGGGATGTAAAATGG + Intronic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135617006 16:23920098-23920120 CTGTTGATGGGAATGCAAAATGG - Intronic
1137019231 16:35407094-35407116 TTGAGATTGGGGATGGGAAATGG - Intergenic
1137964489 16:52916984-52917006 TTTTGAATGGTTATGGAAAATGG - Intergenic
1138557243 16:57778973-57778995 CTGTTAGTGGGAATGTAAAATGG + Intronic
1138643193 16:58402630-58402652 CTGTGAAGTGGGATGGAAAGGGG + Intronic
1139214004 16:65109726-65109748 CTTGGCATGTGGATGGAAAATGG - Intronic
1140000113 16:71016507-71016529 CTGTTACTGGGAATGCAAAATGG + Intronic
1140288934 16:73632208-73632230 CTGGGCATGGGGTTAGAAAAAGG + Intergenic
1140766752 16:78166884-78166906 CTGTCAGTGGGAATGGAAATTGG - Intronic
1140898918 16:79350500-79350522 CTGCAAAGGGGGCTGGAAAAGGG - Intergenic
1141458722 16:84163279-84163301 CTGCTGATGGGGATGTAAAATGG - Intronic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141732986 16:85834741-85834763 CTGGGAATGGGGATGGGGATGGG + Intergenic
1142901187 17:3012835-3012857 CTGAGAATGGCACTGGAAAATGG - Intronic
1144174982 17:12696516-12696538 CTGTTGATGGGAATGTAAAATGG - Intronic
1145409165 17:22640966-22640988 CTGTAAATTGGGATGTAAATTGG - Intergenic
1145788880 17:27611785-27611807 CCGGGAATGGGGAAGGAACAGGG + Intronic
1146596056 17:34170048-34170070 CTGGGAATGGGAAGGGAGAATGG - Intronic
1147399336 17:40170426-40170448 CTCTGACAGGGGTTGGAAAAAGG - Exonic
1147670673 17:42175110-42175132 AGGTGAATGGGGGTGGAAGATGG - Intronic
1147944517 17:44073194-44073216 CTGAAAATGGGGGTGGGAAATGG - Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148520004 17:48264617-48264639 CAGGAAATGGGGAGGGAAAAGGG + Intronic
1149663454 17:58349098-58349120 CTGTTGGTGGGAATGGAAAATGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150955199 17:69850708-69850730 CTGTGGGTGGGAATGCAAAATGG - Intergenic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151487238 17:74408669-74408691 CAGTGAATGAGGATGGGAAAGGG - Intergenic
1153295103 18:3537710-3537732 CTGTTGATGGGAATGCAAAATGG - Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1153760914 18:8331101-8331123 CTGTGAAAAGGAATGCAAAAAGG - Intronic
1153804231 18:8698092-8698114 CTGTGGATGGGAATGTAAAATGG - Intergenic
1153938494 18:9953928-9953950 CTATGGCTGGGGACGGAAAAGGG - Intronic
1155080398 18:22404454-22404476 CTGTTGATGGGAATGCAAAATGG - Intergenic
1155311684 18:24530448-24530470 CTGTGAATGGGGATGACCATGGG + Intergenic
1156016602 18:32553660-32553682 GAGTGAATGGGGCAGGAAAAGGG - Intergenic
1156172249 18:34499568-34499590 TTGTTGATGGGGATGTAAAATGG - Intronic
1156439422 18:37168745-37168767 TTGTGACTGGGGATGGATATTGG + Intronic
1157316245 18:46592377-46592399 TTGTGAATAGGGACTGAAAAGGG - Intronic
1157681516 18:49611158-49611180 CTGTTGATGGGGATGTAAAATGG + Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158392471 18:57054617-57054639 CTGTTAGTGGGAATGTAAAATGG - Intergenic
1159723058 18:71917645-71917667 CTGTTGATGGGAATGTAAAATGG - Intergenic
1160362133 18:78292690-78292712 CTGTGCATGGGATTGGAACAAGG - Intergenic
1160561253 18:79757460-79757482 CTGTGGGTGGGAATGCAAAATGG - Intergenic
1160633828 19:61577-61599 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161082339 19:2317539-2317561 CTGTGAACGGGAATGACAAAAGG + Intronic
1161867193 19:6841795-6841817 CTGTTGGTGGGAATGGAAAATGG - Intronic
1163116073 19:15189231-15189253 CTGTGAATGGGCTGGGAAAGAGG - Intronic
1163667209 19:18608916-18608938 ATCTGAATGGGGTGGGAAAAAGG - Intronic
1164685503 19:30164004-30164026 ATGTGAATGGGGCTGGTGAAGGG - Intergenic
1165180457 19:33963104-33963126 CTGGCTATGGGGATGGCAAATGG + Intergenic
1166726943 19:45034327-45034349 CTGGGGATGGGGGTGGAAAGGGG - Intronic
1167120444 19:47513632-47513654 CTGAGAAGAGGGATGGGAAAAGG - Intronic
1167676033 19:50886556-50886578 CTGTGATTGGAGATGGAGACAGG - Intergenic
1168383033 19:55940393-55940415 TTGTTGATGGGGATGGGAAATGG + Intergenic
1168429733 19:56268779-56268801 CTAGGAATGGGGAGGGAAAGAGG - Intronic
1168677014 19:58285969-58285991 CTCTGCATGGTGATGGAAAAGGG - Exonic
1168697536 19:58412996-58413018 CTTTGAACAGGAATGGAAAAAGG - Intronic
925040460 2:729527-729549 ATGTGAATAGGGATGTAAATAGG + Intergenic
927207038 2:20617308-20617330 GTGTGAAGGGGGAAGGCAAATGG + Intronic
927547096 2:23963687-23963709 CTGTTGATGGGGATGCAAAATGG + Intronic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
927795893 2:26048307-26048329 CTGAGGATGGGGGTGTAAAATGG - Intronic
928013650 2:27633995-27634017 TTGCCAATGGGAATGGAAAATGG - Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928626089 2:33141578-33141600 CTGAGAAGGGGGATGGAGAATGG + Intronic
929077645 2:38091744-38091766 AAGTGAATGGAGATGTAAAATGG + Intronic
929211634 2:39364056-39364078 CTGTTGATGGGAATGTAAAATGG + Intronic
929814051 2:45217235-45217257 CTGTTAGTGGGGATGTAAAATGG + Intergenic
930598438 2:53415753-53415775 CTGTTGATGGGAATGTAAAATGG - Intergenic
931518239 2:63066538-63066560 ATGTGGATGGGGAAGGAAAGGGG - Intergenic
931693442 2:64854642-64854664 CTGTGACTGGGGGTGGGAAGTGG - Intergenic
931723436 2:65084456-65084478 CTGTCAATAGTGAAGGAAAAAGG + Exonic
932018871 2:68062505-68062527 CTGTGAATGTGAATGATAAACGG + Intronic
932050498 2:68393388-68393410 CATTGAAAGGGGATAGAAAAAGG - Intronic
932091451 2:68809548-68809570 GTGTGAAAGGGGGTGGAAAGAGG + Intronic
932124926 2:69136232-69136254 CTGTGAATGGGGGTGGGCAGTGG - Intronic
932130188 2:69180491-69180513 TTGTAACTGTGGATGGAAAAAGG - Intronic
932220697 2:69996827-69996849 CTGAGAATGCTGATGGATAAGGG + Intergenic
932811483 2:74830005-74830027 ATGTGGATGGGGAGGGAAAGAGG - Intergenic
933353989 2:81192587-81192609 CTGTGAATGGGTAGGGAATCTGG + Intergenic
933478563 2:82823541-82823563 CAGGGAATGTGGATGGATAAGGG - Intergenic
933552948 2:83797288-83797310 TAGTGAATGGGGAAGGAGAATGG - Intergenic
933723509 2:85413079-85413101 CTGGGGCTGGGGATGGAAATAGG - Intronic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
936567648 2:113593436-113593458 CTGAGACTGGGGAGGGACAAAGG - Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
936828621 2:116612452-116612474 CTGAAAATGGGGTGGGAAAAGGG - Intergenic
937856068 2:126672730-126672752 CTGTGAAAGGAGGTGGATAAGGG + Intronic
938861578 2:135375088-135375110 CTGCTAATGGAAATGGAAAATGG + Intronic
939318882 2:140589335-140589357 CTGTAAGTGGGAATGTAAAATGG + Intronic
939697994 2:145352070-145352092 TTGTGAATGGTGATTAAAAAAGG + Intergenic
939974395 2:148699828-148699850 CTGTCAGTGGGAATGCAAAATGG - Intronic
940071531 2:149693424-149693446 CTGTGTATGGAGATTGAAATAGG + Intergenic
940233670 2:151485934-151485956 CTATTCGTGGGGATGGAAAAGGG + Intronic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941966593 2:171306591-171306613 CTGTTGATGGGAATGTAAAATGG - Intergenic
943647567 2:190423736-190423758 CTGTGGGTGGGGATTTAAAATGG - Intronic
943762666 2:191626908-191626930 CAGTGTATGGGGATGTAAAGTGG - Intergenic
943861891 2:192876649-192876671 CTGTTAATGGATATTGAAAATGG - Intergenic
944587228 2:201183057-201183079 CTGGAAAAGGGGAGGGAAAAAGG + Exonic
946736033 2:222755481-222755503 CTGGGAATGGGCATGAAAGAGGG + Intergenic
948217235 2:236240760-236240782 CCAAGAATGGGGAAGGAAAAAGG - Intronic
1168746100 20:242553-242575 CAGTGGATGGGGGTAGAAAAAGG - Intergenic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1169381834 20:5113802-5113824 CTGTGAGTGGAGAAGGAAATAGG - Intergenic
1169513287 20:6289090-6289112 CTGTTGATGGGAATGTAAAATGG + Intergenic
1169673380 20:8129419-8129441 CTGTGAACGTGGACGTAAAAAGG - Intergenic
1170346061 20:15388151-15388173 ATGGGAGTTGGGATGGAAAAGGG + Intronic
1170867525 20:20172694-20172716 CTGTGTATGGTGGTGGAGAAGGG - Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171395903 20:24832893-24832915 CTGAGGATGCGGATGGCAAAAGG - Intergenic
1171951269 20:31424668-31424690 GTGTGAAAAGGCATGGAAAATGG + Intergenic
1171965976 20:31530934-31530956 CTGTCAGTGGGAATGTAAAATGG - Intronic
1172851542 20:37969949-37969971 TTGTGGATGGGAATGCAAAATGG - Intergenic
1174665930 20:52257719-52257741 CTGTTTGTGGGGATGTAAAATGG + Intergenic
1174680791 20:52406176-52406198 TTGTGAGTGGAAATGGAAAATGG - Intergenic
1175659426 20:60799317-60799339 CTGCTGATGGGGATGCAAAATGG + Intergenic
1177458056 21:21369550-21369572 CTGTGAGTGGGAATGTAAAATGG - Intronic
1178324396 21:31632079-31632101 CTGTAGATGGGAATGCAAAATGG - Intergenic
1178491766 21:33057052-33057074 CTGGGAGCGGGGATGGAGAAGGG + Intergenic
1178873762 21:36396752-36396774 ATGCGAACAGGGATGGAAAAGGG - Intronic
1178936004 21:36862388-36862410 CTGTTGATGGGAATGTAAAATGG - Intronic
1179029127 21:37704521-37704543 CTGTGAAAGCGGACGGATAATGG - Intronic
1179633175 21:42691183-42691205 CTCTGGATGGTGATGGTAAAGGG - Intronic
1180176030 21:46090078-46090100 ATGGGAATGGGAATGGGAAAAGG + Intergenic
1180937476 22:19635457-19635479 CTGTTCATGGGAATGCAAAATGG + Intergenic
1180949638 22:19715242-19715264 TTGTGTATGGGGAGGGAAAGGGG - Intronic
1181394943 22:22614639-22614661 CTGAGAATGGGGGTGAATAAGGG - Intergenic
1182071623 22:27467626-27467648 CTCTGAATAGGGATGAAGAACGG - Intergenic
1182964318 22:34507030-34507052 CTTTGAATTGGGATGGAACTTGG + Intergenic
1183158289 22:36092526-36092548 CTGTGAATGTGTATGTACAATGG - Intergenic
949722555 3:7007538-7007560 CTGGGAATGGAGAAAGAAAAGGG - Intronic
950120301 3:10477548-10477570 CAGTGGATGGGAAAGGAAAAGGG - Intronic
950278693 3:11686072-11686094 TTGTGTATGGGAATGTAAAATGG + Intronic
950421789 3:12903745-12903767 CTGGGAGTGGGGATGGGAAGAGG + Intronic
951617195 3:24560431-24560453 CTGTGAGGGGAAATGGAAAAAGG + Intergenic
951686646 3:25351732-25351754 GTGAGGATGGGGATGGAACAAGG - Intronic
951966747 3:28395299-28395321 ATGTAAATGGGAATGTAAAATGG + Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952933366 3:38376530-38376552 CTGTGAACGGGGATGCACCAGGG - Intronic
953057238 3:39397857-39397879 CTGTGGCTGAGAATGGAAAATGG - Intergenic
953283884 3:41586040-41586062 CTGTTAGTGGGAATGTAAAATGG + Intronic
953706551 3:45235354-45235376 CTGTTAGTGGGAATGTAAAATGG + Intergenic
953833815 3:46326184-46326206 GTGAGAAGGGGGATGGAATAAGG - Intergenic
954589514 3:51769967-51769989 CTGCTAATGGGAATGCAAAATGG - Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955198823 3:56830943-56830965 CTGTGACTGGGGCTGGGAATAGG - Intronic
955203459 3:56873907-56873929 CTTTGAAGGGGAATGGGAAAAGG + Intronic
955298238 3:57753600-57753622 TTGGGAAGGGGGAAGGAAAAAGG - Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956791826 3:72685960-72685982 CTGTGCTTGGGGCTGGAGAATGG - Intergenic
956894288 3:73643950-73643972 CTGTGAGTGGGGATGGGACTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959195582 3:103176380-103176402 CTGTTAATGGAAATGCAAAATGG - Intergenic
959651857 3:108757999-108758021 CTGAGAATGGTGGGGGAAAAAGG - Intergenic
960148766 3:114230975-114230997 CTGAGAGTGGGAAAGGAAAAGGG + Intergenic
960155651 3:114295104-114295126 CAGTGAATGTGAAAGGAAAAGGG + Intronic
960504186 3:118472864-118472886 CTGTGTATCAGGATGGCAAATGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961073372 3:123959238-123959260 CTGTCAGTGGGAATGTAAAATGG - Intronic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961310202 3:125992584-125992606 CTGTCAGTGGGAATGTAAAATGG + Intergenic
961587321 3:127943288-127943310 CTGTTGATGGGAATGGAAATTGG - Intronic
962565608 3:136655816-136655838 CTGTTGGTGGGGATGTAAAATGG + Intronic
963224685 3:142850403-142850425 GAGTGAATGTGGATAGAAAAAGG + Intronic
963406020 3:144865112-144865134 TTGTTAATGTTGATGGAAAATGG + Intergenic
964951271 3:162296789-162296811 CTGTGAAGCAGGATGGAAACTGG + Intergenic
966978880 3:185111606-185111628 CTGATAGTGGGGATGTAAAATGG + Intronic
967039966 3:185682834-185682856 CTGTTGGTGGGGTTGGAAAATGG + Intronic
967199750 3:187062225-187062247 CTGTTGATGGGAATGGAAAATGG + Intronic
968032833 3:195517314-195517336 GTGTGAATGGGGGAGGAAAGGGG + Intronic
968356338 3:198110470-198110492 TTGAGATTGGGGATGGGAAATGG + Intergenic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
970349388 4:15186114-15186136 CTGTTTATTGGGATGGAAATGGG + Intergenic
970800253 4:19965076-19965098 CTGTTAATGGGAATATAAAATGG - Intergenic
971095723 4:23399791-23399813 CACTGCATGGGGTTGGAAAAAGG + Intergenic
971447849 4:26771233-26771255 CTGTTAGTGGGAATGTAAAATGG + Intergenic
971936130 4:33150063-33150085 CTGTGAAAAGGCATGTAAAAGGG + Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972452950 4:39222024-39222046 CTGTTGATGGGAATGTAAAATGG - Intronic
972882022 4:43436724-43436746 GTGAGAATGGGGGTGGAATAAGG - Intergenic
973107027 4:46352684-46352706 CAGTGAATGGAAATGGACAATGG - Intronic
974778850 4:66525014-66525036 CTATGAATGGGAAAGGGAAATGG + Intergenic
975279058 4:72539566-72539588 CTGTTGATGGGAATGTAAAATGG + Intronic
975667889 4:76751853-76751875 CTGTTAGTGGGAATGTAAAATGG + Intronic
976315294 4:83653447-83653469 CTGAGAACCGGGATGGAAAGTGG + Intergenic
976697392 4:87932126-87932148 CTGTTAGTGGTGATGCAAAATGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977541747 4:98326380-98326402 TTGAGAATGGGGAAGAAAAAAGG - Intronic
977745050 4:100536725-100536747 TTGTAAATGGTGATAGAAAAAGG - Intronic
977998302 4:103523502-103523524 CTGTTGATGGGAATGTAAAATGG - Intergenic
978035645 4:103990114-103990136 CTGTGAATGTGCAGAGAAAAGGG - Intergenic
978128719 4:105168026-105168048 GTTTGAATGGAGATGGAAATTGG - Intronic
978234310 4:106439368-106439390 GTATGAATGGGAATGTAAAATGG - Intergenic
980078425 4:128318763-128318785 CTGTGCATGTGGTGGGAAAAGGG + Intergenic
981485735 4:145284275-145284297 CTGAGAATGGGAATGAAAATAGG - Intergenic
981910326 4:149972496-149972518 CTGCTAGTGGGAATGGAAAATGG + Intergenic
982415389 4:155125305-155125327 CTGTTGGTGGGGATGTAAAATGG + Intergenic
983730919 4:170992129-170992151 TGCTGAATGTGGATGGAAAAAGG - Intergenic
983736246 4:171065483-171065505 CTGTTGATGGGAATGGAAAATGG + Intergenic
984143020 4:176026116-176026138 TTGTGAATGGGAATGAATAATGG + Intergenic
984730210 4:183061068-183061090 CTGTTAATGGGAATGTAAAATGG - Intergenic
984752430 4:183290752-183290774 CTTTGGATGGGAATGTAAAATGG + Intronic
985363215 4:189197892-189197914 ATGTCAATGGGGATGGCAATGGG - Intergenic
986312376 5:6561878-6561900 CTGTTGATGGGAATGAAAAATGG + Intergenic
986619238 5:9653616-9653638 CTATGGATGGGAATGTAAAATGG - Intronic
987239176 5:15976389-15976411 CTGTGGATGGGAATGTTAAATGG + Intergenic
987784454 5:22481241-22481263 CTGTTGATGGGAATGTAAAATGG + Intronic
988624380 5:32856720-32856742 CTATTAATGGGGTTGCAAAAAGG - Intergenic
989445467 5:41523407-41523429 CTGTATAGGGGGATGCAAAAGGG - Intergenic
989474225 5:41856219-41856241 GTGGGAATGGGAATGGAGAAGGG + Intronic
989644322 5:43613147-43613169 CTGTAAATGGGAGAGGAAAAAGG - Intronic
990085600 5:51972402-51972424 CTGTGAGTGGGAATATAAAATGG - Intergenic
990289600 5:54334662-54334684 CTGAGAATGGGGATGTCAGATGG - Intergenic
991609108 5:68432705-68432727 CTGTCAGTGGGAATGTAAAACGG - Intergenic
991943477 5:71877482-71877504 CTGTCCATGTGCATGGAAAAAGG + Intergenic
991996591 5:72393544-72393566 TTGCTGATGGGGATGGAAAATGG - Intergenic
994163697 5:96585236-96585258 TTGTGAGTGGGAATGGAGAAGGG - Intronic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994402753 5:99302184-99302206 CTGTTAGTGGGGATGTAAATTGG + Intergenic
994403597 5:99315261-99315283 GTGAGAGTGAGGATGGAAAAGGG - Intergenic
995856770 5:116600842-116600864 TGGGGAATGGGGATGGGAAAGGG + Intergenic
995947597 5:117667896-117667918 CTGGGAATGGGGTTGGGCAAGGG + Intergenic
995982796 5:118126296-118126318 CTGTTAATGGCAATGTAAAATGG + Intergenic
997008384 5:129847873-129847895 AGGTGAAAGGGGATGGTAAAAGG - Intergenic
997109838 5:131062807-131062829 CTGTTACTGGGAATGCAAAATGG + Intergenic
997731895 5:136187568-136187590 CTGTGATTGGGGAGGCAATATGG + Intronic
998244804 5:140490171-140490193 ATGTGATTAGGGATGGACAAAGG + Intronic
998274980 5:140743911-140743933 CTATTAATGGGAATGTAAAATGG - Intergenic
998488269 5:142523014-142523036 CTGTGAATGGGGAAAGAAAGGGG - Intergenic
998923622 5:147098515-147098537 TTGGGAATGGAAATGGAAAAGGG - Intergenic
999139789 5:149351857-149351879 CTGCAAATGGGGATGAGAAAGGG - Exonic
999595769 5:153202554-153202576 CTGTTAATGGAGCTTGAAAATGG - Intergenic
999648373 5:153741295-153741317 CTGTGAGTGAGAATGAAAAATGG + Intronic
1000305678 5:159992283-159992305 CTGCTGATGGGGATGTAAAATGG + Intergenic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1000907908 5:166985710-166985732 CTGTGGATGAGTGTGGAAAACGG + Intergenic
1000949177 5:167459613-167459635 CTGTTGATGGGTATGGAAAATGG - Intronic
1001258983 5:170209954-170209976 CTGCTGATGGGAATGGAAAATGG - Intergenic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002119850 5:176994456-176994478 CTGCTAATGGGAATGTAAAATGG + Intronic
1003391673 6:5718665-5718687 CTGCAAATTGGGAGGGAAAAGGG - Intronic
1003411535 6:5867587-5867609 CTGTCAGTGGGCATGTAAAATGG + Intergenic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1003859626 6:10310468-10310490 CTTTGAAATGTGATGGAAAAAGG - Intergenic
1004058940 6:12171519-12171541 CTGTGAGAGGGGCTGGAAATAGG + Intergenic
1004290058 6:14358564-14358586 CTGGGAGTGGGGATGCAAAGAGG + Intergenic
1004379129 6:15117054-15117076 TTGACAATTGGGATGGAAAAGGG - Intergenic
1004450812 6:15744164-15744186 CTGTGAATGGGAATGTAAATTGG - Intergenic
1005018483 6:21395689-21395711 CTTTGAATGGAGATGAAAGATGG + Intergenic
1005688378 6:28277717-28277739 TGGGGAATGGGGATGGGAAATGG - Exonic
1005834710 6:29699494-29699516 CTGCTAATGGGAATGGAAAACGG - Intergenic
1006710576 6:36065677-36065699 CTGGAAATGGGATTGGAAAAAGG + Intronic
1007226915 6:40321559-40321581 CAGGGAGTGGGGATGGAAAGGGG + Intergenic
1007708914 6:43809031-43809053 CTGTTAGTGGGAATGTAAAATGG - Intergenic
1008401670 6:51070279-51070301 CTGTGAATGACAATGGAGAAGGG - Intergenic
1008809600 6:55479932-55479954 TTGGTAATGGGGATGGGAAATGG - Intronic
1008855735 6:56084458-56084480 CTGGGAATGGGAATGGAATTTGG + Intronic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1010374712 6:75153832-75153854 CTATGACTTGGGAAGGAAAATGG - Intronic
1010771104 6:79832077-79832099 CTTTGAATGGGAATGGAAAAAGG - Intergenic
1012544260 6:100398866-100398888 CTATTAATGGGAATGTAAAATGG - Intronic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013382343 6:109587888-109587910 CTGTTAATGGGAATGTAAATTGG - Intronic
1013544870 6:111146334-111146356 CTGTGGATGGGAATGTAAAATGG + Intronic
1013974370 6:116060189-116060211 CTGTGACTGGGGAGAGCAAAGGG + Exonic
1014770231 6:125451802-125451824 GTGAGAATGAGGATTGAAAATGG - Intergenic
1014952488 6:127573425-127573447 CTGTTATTGAGGATGGGAAAAGG + Intronic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015733287 6:136370309-136370331 CTGTTAGTGGGAATGTAAAATGG + Intronic
1015912604 6:138183787-138183809 CCGTAAATGGAGATGGAAACGGG + Intronic
1016071467 6:139744124-139744146 CTGTGCATGGATATGGAAAAGGG + Intergenic
1016151883 6:140750728-140750750 CTGGGAGTGGAGTTGGAAAAGGG + Intergenic
1017329805 6:153183147-153183169 CTGAGAGTGAGGATGGAAAAGGG + Intergenic
1017432911 6:154388611-154388633 CTGTTGATGGGAATGCAAAATGG - Exonic
1018348702 6:162931800-162931822 CTGTTGATGGGAATGTAAAATGG + Intronic
1018443955 6:163838007-163838029 CAGTGCAGGGGGATGGGAAAGGG - Intergenic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019308959 7:349661-349683 CTGTTAATGAGGATGGACACAGG - Intergenic
1020282335 7:6655955-6655977 CTGTGAATGGGGCCAGGAAACGG + Exonic
1020458741 7:8404086-8404108 CTGTTGATGGGAATGTAAAATGG + Intergenic
1020509114 7:9030462-9030484 CTGAGAATTGGGATGTAAATGGG + Intergenic
1020889039 7:13855723-13855745 CTGTTGATGGGAATGTAAAATGG - Intergenic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1022176537 7:27876460-27876482 GTGTTAATGGGACTGGAAAATGG - Intronic
1022501360 7:30884087-30884109 TTGTGACGGGGGATGCAAAATGG + Intronic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1023247173 7:38217379-38217401 GTGTGAATGGGGCTGCAAATGGG + Intronic
1024799673 7:53061424-53061446 CTGTGTCTGGGGATGTGAAATGG + Intergenic
1024815188 7:53260803-53260825 CTGTTAATGGGAATGTAAATTGG - Intergenic
1026684314 7:72495166-72495188 CTTCAAATGGGAATGGAAAATGG - Intergenic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027355705 7:77352536-77352558 TTTTTAATGGGGCTGGAAAAAGG + Intronic
1027551532 7:79603036-79603058 TTGTGAAAGGAGATGGAAATTGG - Intergenic
1028366906 7:90042728-90042750 CTGTTGATGGGAATGCAAAATGG - Intergenic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1029109726 7:98206825-98206847 CTGTGAAGGGGGATGGACAAGGG + Exonic
1029475972 7:100784833-100784855 CTGTGAGTGGGCATGGGAAATGG + Exonic
1029496185 7:100896455-100896477 GTGGGAATGGAGATGTAAAATGG + Intronic
1030220444 7:107093316-107093338 CTGTTAGTGGGAATGTAAAATGG - Intronic
1030870499 7:114749703-114749725 ATGTGAATTGTGAGGGAAAATGG + Intergenic
1031277536 7:119748371-119748393 CTGTGAATGTGCATGCAAATAGG + Intergenic
1031730862 7:125299191-125299213 ATGTGGATGGGGAAGGATAAGGG - Intergenic
1031872734 7:127104399-127104421 ATGTTAATGGGAATGGCAAATGG - Intronic
1032041810 7:128569315-128569337 CTGTTGATGGGAATGTAAAATGG - Intergenic
1032543432 7:132723164-132723186 CTGTTAGTGGGAATGGAAAATGG + Intronic
1032933030 7:136695865-136695887 CTGTTGATGGGGATGTAAATTGG + Intergenic
1033121713 7:138672212-138672234 CCCTGAATGGGGAAGGACAAAGG - Intronic
1033477758 7:141707028-141707050 CTGGGAATGGGGAAGGAATTAGG + Intergenic
1034033397 7:147792799-147792821 CTGTTGATGGGGATGTAAAATGG - Intronic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1034261442 7:149759047-149759069 CTGTGAAGGGCTATGGAAGAAGG + Intergenic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1034870485 7:154679146-154679168 CTGTGGATGGTGATGGACAAGGG - Intronic
1035273922 7:157736173-157736195 CTTTGAATGGTGGTGGGAAAGGG - Intronic
1036423839 8:8624813-8624835 CTGTTAGTGGGAATGTAAAATGG - Intergenic
1036447782 8:8837817-8837839 CTGTGGGTGGGAATGTAAAATGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1037942894 8:22966945-22966967 CTACTGATGGGGATGGAAAATGG + Intronic
1037956010 8:23059432-23059454 CTGTTAATGGGAATGTAAAATGG - Intronic
1038067865 8:23982459-23982481 CTTTCAATGGGGATTCAAAAGGG + Intergenic
1038879729 8:31595520-31595542 CAGTTATTAGGGATGGAAAAGGG - Intergenic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1040655996 8:49508450-49508472 CTGTTGATGGGTATGTAAAATGG - Intergenic
1040743490 8:50610729-50610751 CTGAGAGTAGGGGTGGAAAATGG + Intronic
1040750939 8:50706595-50706617 TTGTGAATGGGTAAGGAAATAGG - Intronic
1041253589 8:55959056-55959078 CGGTCAATGGGAATGTAAAATGG - Intronic
1042148604 8:65758122-65758144 CTATGAATGGGAATGGACACAGG - Intronic
1042157468 8:65860888-65860910 TTGTGAATGGAAATGCAAAATGG - Intergenic
1042220127 8:66465316-66465338 CTGTTAATGGAAATGTAAAATGG - Intronic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1043288212 8:78561895-78561917 CTGAGAATGGGGATACAAAGAGG - Intronic
1043317059 8:78936015-78936037 CTGTTGATGGGAATGGAAATTGG - Intergenic
1044649895 8:94483123-94483145 CTGTTGATGGGAATGTAAAATGG + Intergenic
1045783480 8:105895812-105895834 CTGGGAATGGGGCTGCAAAATGG - Intergenic
1047532119 8:125686252-125686274 CACCGAAAGGGGATGGAAAAGGG - Intergenic
1047737550 8:127779849-127779871 ATTTGAATGGGGATGGGGAAGGG + Intergenic
1047786685 8:128160298-128160320 CTGTGAGTGGAAATGTAAAATGG - Intergenic
1048288774 8:133163822-133163844 CTGTGAAGGGGGCTAGAAGAGGG + Intergenic
1049165782 8:141125033-141125055 CTGTTGTTGGGGATGTAAAATGG - Intronic
1049804498 8:144532775-144532797 CTGTGAACAGGGATGGCACAGGG - Intronic
1049884885 9:20082-20104 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1050375392 9:4967209-4967231 CTGAGAATGGTTAAGGAAAAGGG + Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1050971777 9:11886459-11886481 CTGTGGATGAGAATGTAAAATGG + Intergenic
1051128960 9:13837288-13837310 CTGTGAGTAGGAATGTAAAATGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051767915 9:20544626-20544648 CTGTCATTGGGGATACAAAATGG + Intronic
1052684199 9:31733542-31733564 CTGTGAAATGGGATGGAACTAGG + Intergenic
1053163623 9:35829650-35829672 CTGGGAATGGGGCTGGGACAGGG - Exonic
1053493629 9:38532061-38532083 CTGTTAATGGGAATGTAAAATGG + Intergenic
1055648287 9:78381437-78381459 CTTTGAATGGGGCTGGAGAAGGG + Intergenic
1055980904 9:81999443-81999465 CTGAGAGTGGGAATGTAAAATGG + Intergenic
1056130481 9:83581501-83581523 CTGTTGATGGGAATGTAAAATGG + Intergenic
1056174859 9:84024435-84024457 ATGTTAATGGGAATGTAAAATGG - Intergenic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056739205 9:89238222-89238244 CTGCTAGTGGGGATGTAAAATGG + Intergenic
1057343279 9:94222919-94222941 TTGTGAGTGGTGATGGAAAATGG - Intergenic
1057455781 9:95208781-95208803 CTGCTGATGGGGATGAAAAATGG + Intronic
1057674366 9:97126883-97126905 CTATTAATGGGAATGTAAAATGG + Intergenic
1057840960 9:98485280-98485302 GTGGGAATGGGGTAGGAAAATGG + Intronic
1059624952 9:116053472-116053494 CTGAGAATGAGGATGGAGAAAGG - Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1059894994 9:118853898-118853920 CTGGCAGTGGGGGTGGAAAATGG + Intergenic
1060066719 9:120508579-120508601 CAGTGAGTGGGGCTGGAGAAGGG - Intronic
1060310469 9:122455312-122455334 CTGTTATTGGGAATGTAAAATGG - Intergenic
1060560846 9:124541573-124541595 CTGTTAGTGGGAATGTAAAACGG + Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061549152 9:131323122-131323144 TTGTTGATGGGAATGGAAAATGG - Intergenic
1062232827 9:135491640-135491662 CGGGGAACGGGGATGGGAAAAGG + Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1187361951 X:18636860-18636882 CTGGGAAAGGGGATGGAAGGTGG - Intronic
1187492604 X:19766111-19766133 CTGTCGGTGGGGATGTAAAATGG - Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188388046 X:29585621-29585643 CTGTTAGTGGGAATGTAAAATGG - Intronic
1188507776 X:30901584-30901606 CTGTGACTGGCGATGACAAATGG - Intronic
1189535639 X:41932672-41932694 CTGTTGGTGGGGATGTAAAATGG + Intergenic
1189690906 X:43616006-43616028 TTGTGAATGGGGATTGAAAGAGG + Intergenic
1189694289 X:43647756-43647778 CTGTGAACTGGTATGGAATATGG - Intergenic
1189895886 X:45656209-45656231 CTGTTAATTGGAATGTAAAATGG - Intergenic
1190219442 X:48501665-48501687 CTGTCAGTGGGGATGTAAAATGG - Intergenic
1190450219 X:50571923-50571945 TTGTTAGTGGGGATGAAAAATGG - Intergenic
1192238294 X:69310258-69310280 CTCGGTATGGGGATGGGAAAGGG - Intergenic
1193756137 X:85410690-85410712 CAGAGAATGGGGAGGGCAAAAGG - Intergenic
1193892237 X:87063871-87063893 CTGTTGATGGGAATGAAAAATGG + Intergenic
1194009683 X:88545818-88545840 CTGTGGCTGGGAATGTAAAATGG + Intergenic
1194164696 X:90500897-90500919 CTGTGAGTGTGGATGAACAATGG - Intergenic
1194394598 X:93366527-93366549 CTGTTAATGAGAATGCAAAATGG - Intergenic
1195625700 X:107004053-107004075 GTGTGAATTGGGATGGTAAAAGG + Intergenic
1196756618 X:119162825-119162847 CTGTTAGTGGGAATGCAAAATGG + Intergenic
1196852048 X:119947047-119947069 CTGTGATTTGGGATGGAGATTGG + Intergenic
1197347985 X:125347219-125347241 TTGTGGATGGAGATGCAAAATGG + Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1197802264 X:130363645-130363667 CTGTCAGTGGGAATGTAAAATGG - Intronic
1198018004 X:132631319-132631341 CTGGGAGTGAGGATGGAAAAGGG + Intronic
1198022215 X:132670437-132670459 ATGTGTGTGGGCATGGAAAAAGG + Intronic
1198069880 X:133137678-133137700 CTGTTGATGGGAATGTAAAATGG - Intergenic
1198124947 X:133634218-133634240 TTGTTAATGGGAATGTAAAATGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1198661754 X:138976540-138976562 CTCAGAAGGGGGATGGTAAAAGG + Intronic
1199544261 X:148990665-148990687 ATTTCATTGGGGATGGAAAATGG - Intronic
1199663386 X:150076520-150076542 CTGTTAGTGGGAATGGAAGATGG - Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1199894792 X:152118767-152118789 GTGGGGATGGGGATGGAAATGGG + Intergenic
1199943540 X:152647968-152647990 GTGGGAAGGTGGATGGAAAAAGG - Intronic
1199947113 X:152679074-152679096 CTATGAGTGGGGGTGGAAATGGG - Intergenic
1199962568 X:152789380-152789402 CTATGAGTGGGGGTGGAAATGGG + Intergenic
1200272195 X:154696645-154696667 TTGTGAATGGGGTAGGACAAGGG - Intronic
1200510956 Y:4078691-4078713 CTGTGAGTGTGGATGAACAATGG - Intergenic
1201158702 Y:11153280-11153302 CTGTCATTGGGGATGGAGAGGGG + Intergenic