ID: 1077876163

View in Genome Browser
Species Human (GRCh38)
Location 11:6308569-6308591
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077876163_1077876167 26 Left 1077876163 11:6308569-6308591 CCCTCATCACTATTAACATTTTG No data
Right 1077876167 11:6308618-6308640 TTTTAATTTTAAAACATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077876163 Original CRISPR CAAAATGTTAATAGTGATGA GGG (reversed) Intergenic
No off target data available for this crispr