ID: 1077877276

View in Genome Browser
Species Human (GRCh38)
Location 11:6319402-6319424
Sequence ATCCGGTGCGCCGCAGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077877268_1077877276 18 Left 1077877268 11:6319361-6319383 CCGGCCCGAAAGGGCCCTTCGGA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1077877271_1077877276 13 Left 1077877271 11:6319366-6319388 CCGAAAGGGCCCTTCGGAGGCTC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1077877272_1077877276 4 Left 1077877272 11:6319375-6319397 CCCTTCGGAGGCTCTGTACCTTC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1077877273_1077877276 3 Left 1077877273 11:6319376-6319398 CCTTCGGAGGCTCTGTACCTTCT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1077877266_1077877276 23 Left 1077877266 11:6319356-6319378 CCTTTCCGGCCCGAAAGGGCCCT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1077877270_1077877276 14 Left 1077877270 11:6319365-6319387 CCCGAAAGGGCCCTTCGGAGGCT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077877276 Original CRISPR ATCCGGTGCGCCGCAGCCGC TGG Exonic
900581644 1:3412585-3412607 ATCCGGCGAGGAGCAGCCGCTGG + Exonic
901089891 1:6634254-6634276 TTCCCGTGCGCCTCTGCCGCAGG - Exonic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
906640403 1:47437867-47437889 TTCCGTTGCGCCCCAGCGGCGGG + Exonic
908534633 1:65066695-65066717 CTCCGGACCGCCGCCGCCGCGGG + Intergenic
913594154 1:120357268-120357290 ATCCTGTGCGGGGCAGCCTCTGG + Intergenic
916233350 1:162561663-162561685 ATCCGGGGGGCCGCGGCGGCGGG - Exonic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1078421300 11:11215294-11215316 ACCCCGTGCGCCCCAGCTGCTGG - Intergenic
1080551265 11:33375944-33375966 CTCCGCTGCGCGGGAGCCGCCGG + Intergenic
1081773996 11:45665497-45665519 ACCCGGAGCGCCGCAGCCCCGGG + Exonic
1082076608 11:47980451-47980473 CTGCGGAGCTCCGCAGCCGCCGG + Intergenic
1083572614 11:63768520-63768542 ATCCGGCGGGCGGCAGCCGTCGG + Exonic
1084021610 11:66421155-66421177 AGCTGGAGCTCCGCAGCCGCCGG + Exonic
1084180854 11:67445118-67445140 AGCCGGTGCCCCAGAGCCGCTGG - Intergenic
1090327890 11:125904594-125904616 AGCCGGGGGGCCACAGCCGCGGG + Intronic
1091493043 12:949493-949515 ATCAGGTCCACCGCAGCCCCAGG + Intronic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1119015259 14:71044658-71044680 CCCCGGTGCCCTGCAGCCGCTGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121691027 14:95877088-95877110 ACCCGGAGCGCCGGAGCCGCAGG - Intergenic
1122316360 14:100828017-100828039 AGGCGCTGCGCCGCAGCCACAGG + Intergenic
1132028530 15:98422057-98422079 CCCCGGTGCGCCGCCGCCGATGG + Intergenic
1132314441 15:100879856-100879878 AGCCGGTGCGCCGCAGACTAGGG + Exonic
1135577330 16:23596029-23596051 ATCCGGGGCGCGCCAGCTGCAGG - Intronic
1139750382 16:69106290-69106312 CTCCGGAGCGCGGCAGCCGGCGG + Intronic
1142060161 16:88023998-88024020 ATCCCGTGAGCCTCAGCAGCCGG + Intronic
1143508845 17:7384296-7384318 ATCCGGAGGGCAGCAGCCGAGGG + Intronic
1147629162 17:41918935-41918957 ATCCGGAGCACCCCAGCAGCCGG + Exonic
1148725749 17:49788810-49788832 AACCGTCGGGCCGCAGCCGCCGG + Exonic
1152758921 17:82098354-82098376 ACCCGGCGCGCCGCCGCCGGTGG + Intergenic
1152896668 17:82915236-82915258 ATCAGGTGCGCCCTGGCCGCAGG + Intronic
1166876826 19:45902568-45902590 ACCGGCTCCGCCGCAGCCGCCGG + Exonic
1167309539 19:48729073-48729095 ATCGTGCGCGCCGCAGCCGCCGG - Exonic
946339196 2:219057415-219057437 GTCCGGTGAGCCGCCGCCGGGGG - Exonic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
1173210743 20:41029478-41029500 CTCCGGGGCCCCCCAGCCGCCGG + Intronic
1180231993 21:46432165-46432187 CTCCACTGCTCCGCAGCCGCTGG - Exonic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
976146129 4:82044193-82044215 AGCCCCTCCGCCGCAGCCGCGGG - Intronic
996379106 5:122845735-122845757 TTCCTGGGCGCAGCAGCCGCAGG - Intronic
998095640 5:139394376-139394398 AACCGGTGCGCAGGAGCAGCCGG + Exonic
999252320 5:150190216-150190238 AGCCGGTGCGCGGGAGCCGCGGG + Exonic
1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG + Intronic
1001401094 5:171446825-171446847 ACCCGGTGAGCCCCAGCCCCAGG + Intronic
1011434478 6:87322494-87322516 CGCCGCTGCGCCGCAGCCTCCGG + Intronic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1013556204 6:111259572-111259594 AGCCGCTGCCCCGCAGCCGGGGG - Exonic
1014098242 6:117482795-117482817 CGCCAGTGCGCCGCCGCCGCGGG - Exonic
1017021449 6:150143233-150143255 AACCCGTGCGCCGCCGCCGCTGG - Exonic
1019455498 7:1124858-1124880 ACCCGCTGCGCGGGAGCCGCAGG + Intronic
1022734524 7:33063243-33063265 GTCCCTTCCGCCGCAGCCGCGGG + Intergenic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1026830575 7:73607597-73607619 TTCCGGTGCGCATCAGCCTCAGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1039543040 8:38386967-38386989 ATCAGGCGCGCCGAAGCCGCCGG + Intronic
1039921228 8:41895966-41895988 CTCGGGCGCGCCGCACCCGCTGG - Intronic
1042784925 8:72536797-72536819 CCCGGGTGCGCGGCAGCCGCGGG + Intergenic
1199793434 X:151175562-151175584 AGGAGCTGCGCCGCAGCCGCGGG - Intergenic