ID: 1077885542

View in Genome Browser
Species Human (GRCh38)
Location 11:6384883-6384905
Sequence CACTCTGTCCTTCCTTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077885542_1077885545 9 Left 1077885542 11:6384883-6384905 CCTCCATAAGGAAGGACAGAGTG No data
Right 1077885545 11:6384915-6384937 CCTGAATCTACTGTCCTGAATGG No data
1077885542_1077885547 25 Left 1077885542 11:6384883-6384905 CCTCCATAAGGAAGGACAGAGTG No data
Right 1077885547 11:6384931-6384953 TGAATGGACAGTAACAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077885542 Original CRISPR CACTCTGTCCTTCCTTATGG AGG (reversed) Intergenic
No off target data available for this crispr