ID: 1077886350

View in Genome Browser
Species Human (GRCh38)
Location 11:6390634-6390656
Sequence CCCCAGGTCCGGCCGGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077886340_1077886350 9 Left 1077886340 11:6390602-6390624 CCCCGCTACGGAGCGTCACTCCG 0: 1
1: 0
2: 0
3: 1
4: 82
Right 1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 336
1077886341_1077886350 8 Left 1077886341 11:6390603-6390625 CCCGCTACGGAGCGTCACTCCGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 336
1077886342_1077886350 7 Left 1077886342 11:6390604-6390626 CCGCTACGGAGCGTCACTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077886350 Original CRISPR CCCCAGGTCCGGCCGGGAGC AGG Exonic
900154183 1:1197534-1197556 CCCCAGGTGCGGCCGCGGGTCGG - Exonic
900210874 1:1455329-1455351 AGCCAGGACCGGCCTGGAGCTGG - Intronic
900216696 1:1485648-1485670 AGCCAGGACCGGCCCGGAGCTGG - Intronic
900223778 1:1523375-1523397 AGCCAGGACCGGCCCGGAGCTGG - Intronic
900487195 1:2928599-2928621 CCGCAGGTGCGGCCGGGATGAGG + Intergenic
900599611 1:3497417-3497439 GGCCAGGACAGGCCGGGAGCAGG + Intronic
900656842 1:3762806-3762828 CCCCAGGTCAGGGCTGCAGCAGG - Intronic
900778160 1:4600081-4600103 CCGCAGGACCAGCCGGGAGAAGG + Intergenic
901037113 1:6343060-6343082 TCCCAGGGCGGGCAGGGAGCAGG + Intronic
901086054 1:6613271-6613293 CCCGAGGCCTGGCCGGGAGTAGG - Intronic
901088207 1:6625036-6625058 CCCCAGGGTCGGACGGGACCCGG - Intronic
903339317 1:22644037-22644059 CCCAAGGTGGGGCAGGGAGCTGG - Exonic
903354305 1:22736859-22736881 CCCCAGGTCTGACAGGGAGGGGG - Intronic
903438242 1:23368502-23368524 CCCCATGGCCTGCCGGGAGTTGG + Intronic
903589739 1:24445707-24445729 CCCAAGGTCTGACTGGGAGCTGG - Intronic
903677099 1:25071289-25071311 CCCAAGGGCAGGCCTGGAGCTGG + Intergenic
903863245 1:26378458-26378480 CCCCAGGTCAGGAAGGGATCTGG + Intergenic
903919244 1:26787899-26787921 CTCCAAGTCCGGGCAGGAGCGGG + Intronic
904744511 1:32702762-32702784 GCCCGGGGCCGGCCGGGATCCGG - Exonic
905309737 1:37041103-37041125 CCCCAGGTCCAGAGGGGAGTGGG + Intergenic
905482883 1:38273665-38273687 CACCAGGTCAGGCCTGGAGCGGG + Intergenic
905867052 1:41382207-41382229 GCCCAGGCCCGGCCCGGTGCTGG + Exonic
906746557 1:48226089-48226111 CCCCAGGGATGGCGGGGAGCTGG + Intronic
907046601 1:51303505-51303527 CCCAAGGTCTGGTTGGGAGCAGG + Intronic
907248768 1:53123991-53124013 CCCCAGGACAGGCCGTGAGCAGG - Intronic
907268546 1:53277112-53277134 CCCCAGGTCGGCCGGGGAGGGGG - Intronic
909075711 1:71047984-71048006 CTCCCGGTCCGGCCAGGAGCAGG - Intergenic
912404539 1:109426178-109426200 CCCCAGGTCCGGCCAGTCTCGGG + Intronic
915128342 1:153680635-153680657 TCCCAGGGCCTGCGGGGAGCAGG - Exonic
915286751 1:154858193-154858215 CACCAGGTCCAGCCCAGAGCAGG + Intronic
917461640 1:175235256-175235278 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
920671575 1:208007441-208007463 CCCCAGGTCTGACCAGAAGCAGG + Intergenic
922102695 1:222488325-222488347 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1065177778 10:23095697-23095719 CCCCAGTCCCGGCCCGGTGCCGG - Exonic
1067428734 10:46228208-46228230 CCCCAGGCCAGGAAGGGAGCAGG + Intergenic
1067431379 10:46248213-46248235 CCCCAGGCCCAGCCAGTAGCAGG + Intergenic
1067498013 10:46776105-46776127 CCCCAGGCCCGCCCCGCAGCAGG + Intergenic
1067596633 10:47564309-47564331 CCCCAGGCCCGCCCCGCAGCAGG - Intergenic
1069052615 10:63811459-63811481 CCCCACGTCCGGGAGGGAGGTGG - Intergenic
1069129517 10:64681735-64681757 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1069846774 10:71377498-71377520 CCGCGGGGCAGGCCGGGAGCCGG + Intergenic
1070154569 10:73825426-73825448 CCCCTGGTCTGGCCTGGAGGAGG + Intronic
1070677355 10:78421156-78421178 CCCCAGGTTTGGCGGGGAGCAGG + Intergenic
1071602096 10:86963299-86963321 CCCCAGGTCCTCCCAGGAACAGG + Intronic
1073178304 10:101569669-101569691 CCCCAGCTCAGCCCGGGAGGAGG + Intergenic
1073217292 10:101843581-101843603 CCCACGGCCCGGGCGGGAGCGGG - Intronic
1075591154 10:123692588-123692610 CCCCAGGTCCGGCCCAGCCCAGG - Exonic
1075815426 10:125261240-125261262 CGGCAGGTCAGGCCGGGAGGAGG + Intergenic
1075982687 10:126755183-126755205 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1076480874 10:130784569-130784591 CCCCAGGGCCCGCCTGGTGCTGG - Intergenic
1077023130 11:428458-428480 ACCAAGGTGGGGCCGGGAGCAGG - Exonic
1077026038 11:440412-440434 GCCCAGATCCAGCCTGGAGCTGG + Intronic
1077252213 11:1565751-1565773 CCCCAGGCCCGCCCCGCAGCAGG + Exonic
1077254096 11:1572817-1572839 TCCCAGGTCCGCCCGAGTGCAGG - Intergenic
1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG + Exonic
1079115693 11:17639294-17639316 TCCCAGGCCTGGCCTGGAGCTGG + Intronic
1080012321 11:27471996-27472018 CCCCAGGCCCGGGCGGCGGCGGG + Intronic
1081705976 11:45181998-45182020 GCCCAGGAGCTGCCGGGAGCAGG - Intronic
1083868396 11:65471387-65471409 CTCCAGGTCCGGCAGTGAGGAGG - Intergenic
1084182229 11:67452537-67452559 TCCCAGGCCCGGCATGGAGCTGG - Exonic
1084549524 11:69832835-69832857 ACCCAGGGCCGACCAGGAGCTGG - Intergenic
1086366168 11:86110956-86110978 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1086948358 11:92866656-92866678 CCCCCGGGCCGGCCAGGAGCAGG + Intronic
1087468916 11:98546352-98546374 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1088268497 11:108009633-108009655 GACCAGCTCTGGCCGGGAGCGGG + Intronic
1088693899 11:112349947-112349969 CCCCAGGTCCCTCCCAGAGCTGG - Intergenic
1090390273 11:126383450-126383472 CCTCAGGGCTGGCCGGGGGCTGG - Intronic
1090768295 11:129895713-129895735 CCCCAGGCCCAGCCGCGCGCAGG - Intergenic
1091330448 11:134727742-134727764 CCCCAGGTCCTGCATGGAGTGGG - Intergenic
1092502793 12:9065010-9065032 CCCCAGGCAGGGCCGTGAGCCGG + Intergenic
1094501373 12:31023701-31023723 CCCCAGTGCCAGCCCGGAGCTGG + Intergenic
1095949112 12:47772244-47772266 CCCAGCTTCCGGCCGGGAGCTGG - Intronic
1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG + Exonic
1096143912 12:49264947-49264969 CCGCGGGTGCGGCCGGGCGCAGG + Exonic
1096699235 12:53371413-53371435 CCTCAGGCCCAGCCCGGAGCTGG - Intergenic
1097195453 12:57240292-57240314 CCCCAAGCCCGGCCAGGAGCCGG - Intronic
1099777357 12:87150973-87150995 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1101381302 12:104216051-104216073 CCCCAGGTCACCCCGGGAGACGG + Intronic
1103436971 12:120934290-120934312 GTCCAGGTCCTGCCGGGAGCAGG + Intergenic
1103722237 12:122981073-122981095 CCCCAAGGCCGGCCGCGGGCGGG - Exonic
1104702424 12:130917426-130917448 CCTCAGTGTCGGCCGGGAGCCGG - Intergenic
1104811464 12:131622475-131622497 CCCCGGGTCCCCCAGGGAGCTGG - Intergenic
1104989646 12:132618608-132618630 TCCCAGGTGGGGCTGGGAGCGGG - Intergenic
1105250883 13:18697843-18697865 CCCCAGGTCCATCCCTGAGCAGG + Intergenic
1105382163 13:19897463-19897485 CCCCTGGGCAGGCCAGGAGCAGG + Intergenic
1109213514 13:59562677-59562699 CCCTAGTACCGGCCTGGAGCTGG - Intergenic
1110204464 13:72896142-72896164 CCCCAGTACCAGCCTGGAGCTGG + Intronic
1110661145 13:78060596-78060618 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1113269877 13:108662084-108662106 CCCCAGTACCAGCCTGGAGCTGG - Intronic
1113330278 13:109319791-109319813 CCCCAGTACCAGCCCGGAGCAGG + Intergenic
1115299316 14:31865987-31866009 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1117424656 14:55580937-55580959 CCCCAGGTCAGGGCGGGAGGCGG + Intronic
1117510726 14:56448439-56448461 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1118899204 14:69972628-69972650 CCTCTGGGCCAGCCGGGAGCTGG + Intronic
1119654044 14:76404005-76404027 CACCATGCCCGGCTGGGAGCAGG + Intronic
1121050373 14:90816090-90816112 CCCGAGGCGCGGCCGGGCGCGGG - Intronic
1122151967 14:99730439-99730461 CCGCAGGCCTCGCCGGGAGCCGG + Intergenic
1122645126 14:103189131-103189153 CCCCAGGCCTGGGCGGGCGCAGG + Intergenic
1202852759 14_GL000225v1_random:31336-31358 CCCCGGGTCGGGACGGGATCAGG + Intergenic
1125275105 15:37980433-37980455 ACCCAGGATCGGCAGGGAGCCGG - Intergenic
1127931767 15:63601501-63601523 CCCCAGGACACTCCGGGAGCCGG - Exonic
1128073814 15:64813708-64813730 TCCCAGGTCCAGCTGTGAGCAGG - Intergenic
1128511475 15:68316344-68316366 CCCCAGGTGGGGCAGGGAGGAGG - Intronic
1129097537 15:73225103-73225125 CCCCAGTACCAGCCTGGAGCTGG - Intronic
1129200249 15:73994439-73994461 TGCCACGTCCTGCCGGGAGCTGG - Intronic
1129431682 15:75504491-75504513 CCCCACGTCCGGGAGGGAGGTGG + Intronic
1131184778 15:90265256-90265278 CCCTAGGTGCGGCCCGGGGCTGG + Intronic
1132252415 15:100343470-100343492 CCCCAGGCCTGGCCAAGAGCAGG - Intergenic
1132527500 16:425070-425092 CCCCGGGTCCGCGCGGGACCCGG + Intergenic
1132614867 16:835451-835473 CCCCAGGCCAGGCCAGGGGCTGG + Intergenic
1132674661 16:1116740-1116762 CCAGAGGTCCTCCCGGGAGCAGG + Intergenic
1132681521 16:1144390-1144412 CCCCAGGCCCGGCTGGGGCCTGG - Intergenic
1132720926 16:1315283-1315305 CCCCAGGTCCCGCCTGGATGAGG - Intronic
1132751862 16:1461340-1461362 CCCCAGGCCCGGCCGGCACCAGG + Intronic
1132754246 16:1474929-1474951 GTCCTGGTCCGGCCGGGACCGGG - Exonic
1133137546 16:3722294-3722316 CCACAGGTCCAGCCGGGCGCAGG - Intergenic
1133771194 16:8868193-8868215 CCCAAGGCCCTGCCTGGAGCGGG + Exonic
1134507667 16:14821251-14821273 CCCCATGTCCAACTGGGAGCTGG + Intronic
1134613550 16:15630840-15630862 CACCACGCCCGGCCGGGACCAGG - Intronic
1134656029 16:15949387-15949409 CCCCAGGCCCGTCCGCGAGCGGG + Intergenic
1134695367 16:16220013-16220035 CCCCATGTCCAACTGGGAGCTGG + Intronic
1134976464 16:18574673-18574695 CCCCATGTCCAACTGGGAGCTGG - Intergenic
1135752330 16:25067117-25067139 CCCCAGGGCTGGCGGGGAGGCGG - Intergenic
1136585809 16:31183977-31183999 CCCGAGGTGCTGCTGGGAGCTGG - Exonic
1137393900 16:48103659-48103681 CCCCAGGAACAGCAGGGAGCCGG + Intronic
1138353810 16:56362150-56362172 CCCCAGGTCCAGACGGGACAAGG + Exonic
1139515419 16:67449801-67449823 CCCCAGGCCTGGCCCAGAGCAGG + Intronic
1140512420 16:75517590-75517612 CCACAGCTCTGGCCGGGGGCGGG - Intergenic
1141173604 16:81705453-81705475 CCCCAGGAGTGGCCGGGAGAGGG + Intronic
1141746888 16:85931917-85931939 CCCCTGCCCCAGCCGGGAGCGGG + Intergenic
1142170091 16:88617279-88617301 CCGCAGGTCCAGGGGGGAGCTGG - Intronic
1142671997 17:1491683-1491705 GCCCAGGGCCCGCCGGGGGCCGG + Intronic
1143393936 17:6576922-6576944 CCCCAGCTCCGGCGGGCAGAGGG + Intergenic
1143830380 17:9645893-9645915 CCCCATCGCCGGCGGGGAGCTGG - Exonic
1145064629 17:19753733-19753755 CCTCCGGGGCGGCCGGGAGCTGG + Intergenic
1145979892 17:29005301-29005323 CCCCGGGTCCGGCCGCCATCCGG + Intronic
1147044286 17:37742298-37742320 GGCCAGCTCCGGCCGGGAGCCGG + Intronic
1147886664 17:43688870-43688892 CCCCAGGTCCGGGCTGGGTCTGG - Intergenic
1148157202 17:45431219-45431241 CCCGAAGCCCGGGCGGGAGCGGG - Intronic
1149806228 17:59620168-59620190 CTCCAGGTGCGGCCGGGCCCGGG + Exonic
1149994521 17:61399739-61399761 GCCAAGCTCCGGCCGGGAGGGGG - Intergenic
1150218420 17:63482798-63482820 CCCCAGGTCAGGCAGGGTTCGGG + Intergenic
1151362188 17:73595653-73595675 CCCCAGGGCAGGCAGGAAGCTGG + Intronic
1151376767 17:73694618-73694640 CCCCAGGACAGGCGGGAAGCAGG - Intergenic
1152092776 17:78256321-78256343 CCCCAGGCCTGACCTGGAGCTGG - Intergenic
1152809410 17:82374449-82374471 CACCAGGTCCTCCAGGGAGCTGG - Exonic
1153688058 18:7566688-7566710 CGGCGGGCCCGGCCGGGAGCGGG + Intergenic
1155089504 18:22492911-22492933 CCCCAGGTCCTGCTGGGAGTTGG + Intergenic
1157464410 18:47931133-47931155 CCGCCGGTCCGGCCGGGAGGCGG - Intronic
1158589622 18:58768572-58768594 GCTCGGGGCCGGCCGGGAGCTGG + Intergenic
1159906621 18:74097963-74097985 CCCCAGTACCAGCCTGGAGCAGG + Intronic
1160680598 19:410247-410269 CCCCAGGACCAACCCGGAGCCGG + Intergenic
1160862694 19:1244456-1244478 CCCGAGGCCCGGCCAGGGGCTGG + Exonic
1160912582 19:1481766-1481788 CCCCAGGTCTGGCTGCCAGCTGG - Exonic
1160946686 19:1647064-1647086 CCCCGGGCCCGGCAGGAAGCTGG + Intronic
1160995601 19:1880760-1880782 CCCCAGGTGGTGCCAGGAGCAGG + Intronic
1161029289 19:2050543-2050565 CCCCAAGTGAGGCTGGGAGCAGG - Intronic
1161153291 19:2720632-2720654 CGCCGTGCCCGGCCGGGAGCCGG - Intronic
1161219173 19:3110143-3110165 CCCCAGGCACGGGCGAGAGCGGG + Exonic
1161226417 19:3148585-3148607 CCCCAGGCCCAGGCGAGAGCGGG + Exonic
1161397575 19:4052611-4052633 CCCCAGGGCGGGCGGGGGGCAGG + Intronic
1161512058 19:4677379-4677401 CCCCGGGGCTGGCCGGCAGCAGG + Intronic
1162315690 19:9936692-9936714 CCCCAGGCCATTCCGGGAGCGGG + Intergenic
1162496915 19:11028519-11028541 CCACAGGTCAGGCCTGGACCTGG + Intronic
1162672076 19:12266098-12266120 GCCCTGGTCCGGCCGGCAGTCGG - Intronic
1163335740 19:16670647-16670669 TCCCATGTCCAGCCGGGTGCGGG + Intronic
1163708672 19:18832540-18832562 CCCCAGGCCCGGCCGCGATGGGG - Intronic
1163708709 19:18832656-18832678 CCCCCGCTCCGGCCGCGACCTGG + Intronic
1163821715 19:19499862-19499884 CCCCAGGTCCCTCCTGCAGCTGG - Intronic
1165330625 19:35139610-35139632 CCCGGGGTCAGGCCGCGAGCGGG + Intronic
1166875779 19:45896423-45896445 GCCCAGGGCCTGGCGGGAGCAGG - Intronic
1167115786 19:47488351-47488373 CCACTGGTCCAGCCGGGAGATGG + Exonic
1167379027 19:49128108-49128130 CCCCAGGTCTGGGCGGGACAGGG + Exonic
1167467371 19:49657499-49657521 CTCCAGGCCTGGCCGGGACCAGG - Intronic
1168136544 19:54355830-54355852 CCTCAGGACAGGCCGTGAGCCGG + Intronic
1168251752 19:55145995-55146017 TCCAAGGTCGGGCCGGGGGCGGG - Intronic
1168339661 19:55615793-55615815 CGCCGGGTGCGGGCGGGAGCAGG - Exonic
1168642251 19:58038224-58038246 CCCCTGGCCCGGCCCGGGGCAGG - Intronic
926092133 2:10058028-10058050 GCCCAGGTCCAACCGGGAGAGGG - Exonic
926915939 2:17892734-17892756 CCCCAGGACCAGCCCAGAGCTGG - Intronic
929452647 2:42047727-42047749 CCCGAGCTCCGTCTGGGAGCGGG - Intergenic
929936329 2:46297050-46297072 GCCGAGGGGCGGCCGGGAGCCGG - Intronic
931467667 2:62505825-62505847 GACCAGGCCCGGCCGGGGGCGGG + Intronic
932432782 2:71685681-71685703 CCTCAGAGCCAGCCGGGAGCAGG + Intronic
933886311 2:86721138-86721160 TCCCGGGGCCGGCTGGGAGCGGG - Intronic
934079196 2:88452743-88452765 CTCCTGGGCCGGCCCGGAGCGGG + Intergenic
934968739 2:98745910-98745932 CCCCAGGTCCGGCAGGCAGTAGG + Intergenic
936500505 2:113062505-113062527 CCCCATGTCCCGCCGGTAGAAGG - Exonic
937044739 2:118845269-118845291 CACCCGGTCCGGCAGGGGGCCGG - Intronic
937057920 2:118954758-118954780 CCCCAGTACCAGCCTGGAGCTGG + Intronic
937319267 2:120951300-120951322 CCCCAGGGCCAGCCGGGTGCGGG - Exonic
938086331 2:128404530-128404552 CACCAGGCCTGGCTGGGAGCAGG + Intergenic
940639843 2:156334025-156334047 TCCCAGCTCCGGCCGGGAGACGG - Intronic
941768840 2:169327243-169327265 CCCCACGTCCGGGAGGGAGGTGG + Intronic
941769167 2:169327993-169328015 CCCCACGTCCGGGAGGGAGGTGG + Intronic
944457560 2:199911315-199911337 GCCGCGGCCCGGCCGGGAGCCGG - Exonic
944528808 2:200648389-200648411 CCTCAGTACCAGCCGGGAGCTGG - Intronic
944633834 2:201655357-201655379 CCCCATGTCCGGCCGGAGGCAGG + Intronic
945132057 2:206584158-206584180 CCCCAGTACCAGCCTGGAGCCGG - Intronic
947593123 2:231396111-231396133 CCCCAGGTCTTGCCGGCAGCTGG + Intronic
947637760 2:231688717-231688739 CCCGAGGGCAGGCAGGGAGCTGG + Intergenic
947750725 2:232530640-232530662 CCTCAAGTCCTGCCGGGGGCAGG - Intronic
947792754 2:232877190-232877212 CCCCAGGCCTGGCTGGGGGCCGG + Intronic
947903506 2:233742555-233742577 CCCCAATTCCGGCCAGAAGCTGG - Intronic
948126214 2:235566651-235566673 CCGCAGGACCAGCCGGGACCGGG + Intronic
948226874 2:236318144-236318166 CCCAAGGTGCAGCTGGGAGCTGG + Intergenic
948581098 2:238987720-238987742 CCCCAGGCGCTGCCCGGAGCGGG - Intergenic
948603059 2:239118348-239118370 AGCCAGGTCCAGCCGGGTGCAGG + Intronic
948809523 2:240467536-240467558 CCCCAGGGCCGCCTGGCAGCTGG - Exonic
1169074601 20:2752894-2752916 CCCCAAGTCCGGGCGCGAGATGG - Intronic
1169077193 20:2768458-2768480 CCCCAGGGCCTTCCTGGAGCTGG + Intergenic
1171951742 20:31427356-31427378 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1171951799 20:31427474-31427496 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1171957252 20:31471064-31471086 CCCCACGTCCGGGAGGGAGGTGG - Intronic
1172354340 20:34269172-34269194 CCCCACTCCCGGCCGCGAGCAGG + Exonic
1172636849 20:36415837-36415859 CCCCAGGTGAGGCCTGGAGATGG + Intronic
1174414500 20:50358071-50358093 GGCCAGGTCAGGCCAGGAGCTGG - Intergenic
1174453824 20:50636075-50636097 CACCAGGCCCAGCCGGGAGGGGG - Intronic
1175479376 20:59300656-59300678 CTCCAGCTCCGGCCAGGAGTTGG - Exonic
1175598375 20:60253514-60253536 CCCCAGCACTGGCCGGGGGCGGG + Intergenic
1175926544 20:62474234-62474256 CTCCAGGCCCGGCCCGGCGCCGG + Intronic
1176042490 20:63072732-63072754 CCCCAGGTCCTCCGTGGAGCGGG - Intergenic
1176244378 20:64090557-64090579 CCCCATGACCGGGAGGGAGCTGG + Intronic
1176457709 21:6928386-6928408 CCCCAAGTCCGTCCCTGAGCAGG + Intergenic
1176835881 21:13793470-13793492 CCCCAAGTCCGTCCCTGAGCAGG + Intergenic
1178959106 21:37047703-37047725 CCCCAGTGCCAGCCTGGAGCCGG + Intergenic
1179928341 21:44550658-44550680 CCCCAGGGCCAGCCGGGCTCAGG - Exonic
1179939339 21:44628061-44628083 CCCCAGGGCCAGCCGGGCTCAGG + Exonic
1179996585 21:44977131-44977153 CCCCAAGTCCGTCCCTGAGCAGG + Intergenic
1180000877 21:44995041-44995063 CCCCAGGTCTGGCCATGGGCTGG - Intergenic
1180101755 21:45590793-45590815 CCCCGGGTTCGCCCTGGAGCAGG - Intergenic
1180961134 22:19762893-19762915 TCCCAGCTTCGGCCGGCAGCAGG - Intronic
1181047876 22:20224137-20224159 CCGCAGGGCCAGCCGGGCGCAGG + Intergenic
1181313940 22:21960138-21960160 CCCCAGGACCTGCCCAGAGCAGG - Intronic
1181637142 22:24179792-24179814 CCCCAGGCCCTGCAGGGAGGGGG - Intergenic
1181849811 22:25742029-25742051 CTCCAGGTCTGGCCAGGAGACGG - Intergenic
1182444154 22:30380468-30380490 CCCCAGGAACGCCAGGGAGCAGG + Intronic
1183370084 22:37427297-37427319 CCCCAGCCCCAGCCGGGATCCGG + Exonic
1183407558 22:37637986-37638008 CCCCAGCTCCGGCCTGGTGAGGG - Intronic
1183736396 22:39647069-39647091 CCCCAGGCCCGGCCCAGCGCAGG - Intronic
1183737332 22:39651160-39651182 CCCGAGGTCCCGCCGCCAGCTGG + Intronic
1184408385 22:44313004-44313026 CCCTAGGCCCAGGCGGGAGCTGG - Intergenic
1184728829 22:46362161-46362183 TCCCAGGTCCCACGGGGAGCAGG + Exonic
1185280158 22:49966506-49966528 CCCCAGATCCTGCAGGCAGCAGG - Intergenic
1185285845 22:49999652-49999674 GCCCAGGCCTGGCCGGGGGCGGG + Intronic
1185397433 22:50600332-50600354 ACCCGGGTGCGGCCCGGAGCGGG - Intronic
949105452 3:196988-197010 CCCCCGAGCCGGCCGGGAGCCGG - Exonic
950316425 3:12005043-12005065 CCCGAGGTCCCGCTGGGAGGAGG + Intronic
950334507 3:12182793-12182815 CACTAGGTCCGGCTGGGCGCAGG + Intronic
954256523 3:49411565-49411587 CACCAGGCCCGGCCGGGCGGGGG + Intronic
954269716 3:49498162-49498184 CCCCAGGACCATCAGGGAGCTGG - Intronic
955461550 3:59189306-59189328 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
961743146 3:129046436-129046458 CTCCAGGGCAGGCCGCGAGCTGG - Intergenic
961831824 3:129626980-129627002 CCCCTAGGCCGGCTGGGAGCTGG - Intergenic
962271690 3:133982206-133982228 TCCCAGGTCTGGCCTGGACCAGG - Intronic
965216821 3:165874525-165874547 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
967138113 3:186529573-186529595 CCCCAGTTACGGCCAGGAACAGG + Intergenic
967253536 3:187567058-187567080 CCCCAGGTCCTGGCTGGGGCGGG - Intergenic
968473271 4:791575-791597 CTCCAGGTGCCGCCGGCAGCAGG + Intronic
968629151 4:1641319-1641341 CCCCCGGGCCCGCTGGGAGCTGG - Exonic
968913266 4:3486287-3486309 CCCCAGGTCGGGGCGGGTGCTGG + Intronic
969378936 4:6782243-6782265 CCCCAGCGCGGGCCGGGGGCGGG + Intronic
969461936 4:7333597-7333619 CCCCAGGTGAGGCAGGGAGGTGG - Intronic
969682126 4:8649249-8649271 CGCCAGGCCCAGCCTGGAGCAGG + Intergenic
971043333 4:22778730-22778752 CTGCAGGTCCGGGCGGGAGGCGG + Intergenic
971183053 4:24349100-24349122 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
973346374 4:49060274-49060296 CCACAGGGCTGGCCTGGAGCTGG + Intronic
973795807 4:54425188-54425210 CCCCAGGACCTGCAGGGACCTGG + Intergenic
974951030 4:68582943-68582965 CCCCAGTACCAGCCTGGAGCTGG + Intronic
975034031 4:69658883-69658905 CCCCAGTACCAGCCCGGAGCTGG + Intergenic
975517315 4:75260679-75260701 CCCCAGTACCAGCCTGGAGCCGG + Intergenic
976265245 4:83182667-83182689 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
979498373 4:121410970-121410992 ACCCAGTGCCGGCCTGGAGCTGG - Intergenic
985217680 4:187671539-187671561 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
985391997 4:189499747-189499769 CCCCAGGTCAGGCCCCGGGCTGG - Intergenic
985541290 5:488843-488865 ACCCAGGACGGGCCCGGAGCCGG + Intronic
985717621 5:1471551-1471573 TCCCAGGTCAGGGCGGGAGGAGG + Intronic
985924392 5:3004585-3004607 CCCCAGGTCTGGATGGGACCAGG - Intergenic
986986991 5:13511567-13511589 CCCCAGGTGCTGACTGGAGCGGG + Intergenic
987050433 5:14143641-14143663 CGCCAGGCCCGGCGCGGAGCGGG + Intergenic
990247817 5:53881103-53881125 CACCGCGCCCGGCCGGGAGCTGG - Intergenic
990458966 5:56014863-56014885 CCCCATGTCCGGGAGGGAGGTGG - Intergenic
994253265 5:97562392-97562414 CCTCAGATCCTGCTGGGAGCTGG - Intergenic
995016243 5:107312938-107312960 CCCCAGGTCATGCAGGTAGCAGG + Intergenic
995817880 5:116192005-116192027 CCCCAGTACCAGCCTGGAGCCGG + Intronic
997239179 5:132294361-132294383 CCCCATCCCCGGCCGGGCGCGGG - Intronic
997369413 5:133348557-133348579 CCCCAAGTCTGGCCAGGTGCAGG + Intronic
997429394 5:133827022-133827044 CCCCAGGCCCAGATGGGAGCAGG + Intergenic
997588572 5:135059193-135059215 CCCCAGGTTCGGCCGAGAGCAGG - Intronic
998149268 5:139747633-139747655 CCCCACGTCCGGCCGGGCTGCGG - Intergenic
998406765 5:141878530-141878552 CCCCCCCTCCGGCCGGGAGGTGG + Intronic
999279728 5:150357473-150357495 CCCCGGGGCCGGCCGGGACTTGG - Intergenic
1001314011 5:170630011-170630033 CCCCAGGCCCAGCCTGGTGCAGG - Intronic
1003942825 6:11044922-11044944 CCCCGCGTCAGGCCGGGAGCGGG - Intergenic
1006064528 6:31454386-31454408 CCCCACGTCCGGGAGGGAGGTGG - Intergenic
1006064705 6:31454788-31454810 CCCCACGTCCGGGAGGGAGGTGG - Intergenic
1006064958 6:31455394-31455416 CCCCACGTCCGGGAGGGAGGTGG - Intergenic
1006259117 6:32853654-32853676 TCCCAGGCCCGGCCGGGACCGGG - Exonic
1006457772 6:34141836-34141858 CCCCAGGGCAGGCAGGGAGAAGG + Intronic
1006725513 6:36196818-36196840 CCCCAGCGCGGGCCGGGAGGGGG + Exonic
1007557988 6:42782736-42782758 CCCCCGGAGCCGCCGGGAGCCGG + Intronic
1007614070 6:43170456-43170478 CCCCAAGTCCAGCCTGCAGCTGG + Intergenic
1007701780 6:43770119-43770141 CCCCGGGGCGGGCCGGGGGCGGG + Intergenic
1009968897 6:70605340-70605362 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1011258611 6:85449826-85449848 TCCCTGGTCCGGCCGGGATGCGG + Intronic
1015024625 6:128519440-128519462 CCCCGGATCCGGCCTGGGGCTGG - Intronic
1015058240 6:128930055-128930077 CTGCAGGGCCGGCCGGCAGCGGG + Intronic
1016049562 6:139516376-139516398 CACCGCGCCCGGCCGGGAGCAGG + Intergenic
1016590194 6:145735436-145735458 CAGCAGCTCCGGCCGGGCGCCGG + Exonic
1017891608 6:158644283-158644305 CCCCAGCCCCAGCCTGGAGCGGG - Intronic
1019310771 7:359645-359667 CCTCTGGTCCGGCCAGGACCAGG - Intergenic
1019587400 7:1813021-1813043 CACCAGCTCCGGCCGGCAGGCGG - Intergenic
1019692604 7:2424915-2424937 CACCACGCCCGGCCTGGAGCGGG - Intronic
1020106477 7:5424387-5424409 CCCCAGGGGAGGCCGGGGGCCGG - Intronic
1023883405 7:44334504-44334526 CCCCAGGCCTGGCCAGGACCTGG - Intronic
1029734491 7:102457897-102457919 CCCCAGCTTCAGCCGGGAGGTGG - Exonic
1030602833 7:111610238-111610260 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1032345189 7:131110142-131110164 CTCCAGAGCCGCCCGGGAGCAGG + Intronic
1032543150 7:132721019-132721041 CCTCAGCTCCTGCCGGGAGGAGG + Intronic
1036211533 8:6844834-6844856 CCCCAGGTAAGACCGGAAGCCGG - Intergenic
1037713536 8:21376143-21376165 CCCCAGTACCAGCCTGGAGCTGG - Intergenic
1040290989 8:46124477-46124499 CCCCAGGTGCTGCCAGGAGAAGG + Intergenic
1040471616 8:47738823-47738845 CCCCAGGGCCGGCCGGACCCGGG - Exonic
1040567663 8:48582099-48582121 CCTCGAGTCCTGCCGGGAGCCGG - Intergenic
1042122808 8:65507032-65507054 CCCCAGCACCAGCCTGGAGCTGG - Intergenic
1046473922 8:114715832-114715854 CCCCAGGGCCTGTCGGGAGGTGG + Intergenic
1046962347 8:120124880-120124902 CCCCAGGTGCGCGCGGCAGCCGG - Intronic
1047130693 8:122017070-122017092 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1049446856 8:142635188-142635210 GCCCAGGGCTGGGCGGGAGCTGG - Intergenic
1049457344 8:142700421-142700443 CCCCGGGTCTGGCCGGTAGGGGG - Exonic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1050513036 9:6413956-6413978 CCCCAGGCCCCGCCGAGCGCGGG - Intronic
1056402442 9:86241320-86241342 TTCCAGGTCCTGCCCGGAGCTGG + Intronic
1057320782 9:94010664-94010686 CACCAGGCCCGGCCAGGAGAGGG + Intergenic
1057752405 9:97803487-97803509 CCCCAGGCCCGGCCCAGCGCGGG + Intergenic
1058156664 9:101524035-101524057 CCCCAGTACCAGCCCGGAGCTGG - Intronic
1059325398 9:113501290-113501312 CCCCGGGCCCGGCGGGGAGAGGG - Intronic
1060006878 9:120008167-120008189 ACCCAGCTCCGGGTGGGAGCTGG - Intergenic
1060157370 9:121329066-121329088 CCACAGGACTGGCCGGCAGCAGG + Intronic
1060209310 9:121700165-121700187 CTCCTGGGCCAGCCGGGAGCAGG + Intronic
1060941478 9:127545398-127545420 CCCCTGGGCCTGGCGGGAGCTGG - Intronic
1061090672 9:128424267-128424289 CCCCAGGTGAGGCCGGGATGGGG + Exonic
1061264339 9:129496750-129496772 CCCCCGGGCCTGCAGGGAGCCGG + Intergenic
1061277663 9:129578799-129578821 CCCCTGGTCAGGCCAGGAGGAGG - Intergenic
1061544617 9:131297254-131297276 CACCAGGTCCTGCTAGGAGCAGG - Intronic
1062489609 9:136798945-136798967 CCCCAGGACAGGGCGGGAGGAGG + Intronic
1203405430 Un_KI270539v1:2-24 CCCCACGTCCGGGAGGGAGGTGG + Intergenic
1186032532 X:5385503-5385525 CCCCAGGGCCAGAGGGGAGCAGG + Intergenic
1188862758 X:35276299-35276321 TCCCAGGCCCAGCAGGGAGCGGG + Intergenic
1189413660 X:40794914-40794936 CCCCAGTACCAGCCTGGAGCCGG + Intergenic
1191906219 X:66093574-66093596 CCCCAGTTCCAGCCCAGAGCTGG - Intergenic
1193253334 X:79319108-79319130 CCCCAGTACCAGCCCGGAGCTGG - Intergenic
1193643825 X:84043650-84043672 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
1193779590 X:85685865-85685887 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
1193969972 X:88039136-88039158 CCCCGGGTCGGGCGGGGGGCGGG - Intergenic
1194926851 X:99836152-99836174 CCCCAGTACCAGCCTGGAGCCGG - Intergenic
1196464891 X:115961250-115961272 CCCCAGTACCAGCCTGGAGCTGG + Intergenic
1196737556 X:118992860-118992882 CCCCAGTACCAGCCTGGAGCCGG + Intronic
1197146529 X:123178412-123178434 CCCCAGGTAGGGCTGGGAGGAGG + Intergenic
1198001289 X:132440191-132440213 CACCAGGTTCGGCGGGGAGGTGG + Intronic
1199521444 X:148740948-148740970 CCCCAGTACCAGCCTGGAGCTGG - Intronic