ID: 1077886586

View in Genome Browser
Species Human (GRCh38)
Location 11:6391744-6391766
Sequence CTGTGCTGCCGCCGGGGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077886580_1077886586 -5 Left 1077886580 11:6391726-6391748 CCTGACTGTGCAGACCCACTGTG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 174
1077886578_1077886586 11 Left 1077886578 11:6391710-6391732 CCTGGAGGGCACGGACCCTGACT 0: 1
1: 0
2: 2
3: 46
4: 371
Right 1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 174
1077886579_1077886586 -4 Left 1077886579 11:6391725-6391747 CCCTGACTGTGCAGACCCACTGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077886586 Original CRISPR CTGTGCTGCCGCCGGGGTTC TGG Exonic
900118709 1:1039599-1039621 ATGGGCTGCCGCAGGGGCTCTGG + Intronic
900272699 1:1800539-1800561 CTGTGCTGTCCCCGAGGCTCAGG - Intronic
900322449 1:2091826-2091848 CTGTCCTCCCGCCTGGGGTCAGG - Intronic
900535116 1:3173186-3173208 CCTTGCTGCCCCCGGGGCTCAGG + Intronic
902552928 1:17229979-17230001 CTGTGCAGCCTCTGGGGTACAGG - Intronic
902983987 1:20144270-20144292 CACTGCTGCAGCCGGGGCTCTGG + Intronic
906152206 1:43594120-43594142 CTGTGCTGCAGCTGGGGGCCAGG - Intronic
906156432 1:43616783-43616805 CTGTGCTGCTGCTGAGGTTATGG + Intronic
908858252 1:68453280-68453302 CTGTGCTGCCTTTGGTGTTCTGG + Intergenic
909729626 1:78875644-78875666 CTGTGCTGCCGCAAGTCTTCAGG + Intergenic
915358112 1:155268788-155268810 CTGTGCTGCTGTCGGGGGGCAGG + Exonic
916100663 1:161390538-161390560 CTGTGCTCCCGCCCCGGTCCAGG - Intergenic
919945912 1:202318859-202318881 CTATGCTGCGGCCGGGGAGCTGG + Exonic
920188429 1:204176989-204177011 CTGTGCTGCAGCCTGGGTGATGG + Intergenic
922118747 1:222641432-222641454 CTGAGCTGCCCCCAGGGCTCTGG + Intronic
923075401 1:230604571-230604593 CTGTGCTGCCGCAAGGTTTCAGG + Intergenic
1062975967 10:1682948-1682970 CTGTGTTACCGCCGGCATTCGGG - Intronic
1065410513 10:25422253-25422275 CTGTGCAGCCCCAGGGGTTTCGG - Intronic
1066264884 10:33766943-33766965 CTGTGCTGCAGGTGGGGTTCAGG - Intergenic
1069994587 10:72334757-72334779 CTGTGCTGCCGCAGGAGGGCAGG - Exonic
1070243304 10:74705220-74705242 CTGTGCTGCAGCTAGGCTTCTGG - Intronic
1072891752 10:99330295-99330317 CCTCGCTGCCGCCGGGCTTCGGG + Exonic
1073585134 10:104702723-104702745 CTGTTCTGGTGCTGGGGTTCAGG + Intronic
1074704943 10:116122230-116122252 CTGTGCTGCTGCCACGTTTCTGG - Intronic
1075358309 10:121803947-121803969 CTGTGCAGCAGTAGGGGTTCTGG + Intronic
1076358702 10:129871166-129871188 CTGTGCTGCAGGCCGGGTGCTGG + Intronic
1076779540 10:132716625-132716647 CAGTGGTGACGCTGGGGTTCAGG - Intronic
1076868305 10:133180193-133180215 GTGTGCTGCCCGCGGGGGTCAGG - Intronic
1076930545 10:133528972-133528994 CTGTTCAACCGCCGGGGTACAGG + Intronic
1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG + Exonic
1078390299 11:10931162-10931184 CTGCTCTGCCGCTGGGGCTCCGG + Intergenic
1078789179 11:14525811-14525833 CTGTGCTGCCGCAAGGCTTCAGG + Intronic
1080037295 11:27722643-27722665 CTGCCCCGCCGCCGGGGTGCCGG + Intergenic
1081159891 11:39737753-39737775 CTGTGCTGCCACAAGGCTTCAGG + Intergenic
1085197164 11:74679700-74679722 CTGTGCTCCCTCCAGGGATCTGG - Intergenic
1089730066 11:120513736-120513758 CAGTGCTGCCTCTGGGTTTCAGG - Intronic
1089953498 11:122550301-122550323 CTGTGCTGCCGCAAGGTTTCAGG + Intergenic
1091001160 11:131911440-131911462 CCGTGCGGCTGCCGGAGTTCGGG + Exonic
1091108288 11:132943112-132943134 CTGTGCGGCTGCCGGAGTCCTGG - Exonic
1096972875 12:55681715-55681737 CTGTGCTTCCGCTGGGGCACTGG - Exonic
1097592487 12:61589840-61589862 CTGTGCTGCCTCAAGGCTTCAGG + Intergenic
1097794055 12:63843959-63843981 CTTTGCTGCCGCCGGGGGCGCGG + Intergenic
1099872983 12:88371030-88371052 CTGTGCTGCCGCAGGGTTTCAGG + Intergenic
1101150508 12:101878467-101878489 CTGTGCTGCCCCCAGGTCTCTGG + Intronic
1101751068 12:107582767-107582789 CTGTGCTGCCTCCTGTTTTCAGG + Intronic
1102298661 12:111756085-111756107 CTGTGCTGGGGCCGGGGGTTAGG - Intronic
1102426769 12:112849928-112849950 CTGGGCTGCCTCTGGGGGTCAGG + Intronic
1103342645 12:120229259-120229281 CTGTGCTGCAGTCGGGGGTGGGG - Intronic
1103403265 12:120657743-120657765 CTTTGCTGCCCCCGGGGCTTTGG + Intronic
1103541413 12:121669074-121669096 CTGGCCTGCCCCCGGGGCTCTGG - Intronic
1104272512 12:127294797-127294819 CTGTGCTGGATGCGGGGTTCAGG - Intergenic
1104374527 12:128252122-128252144 CTCTCCTGCAGCCAGGGTTCTGG - Intergenic
1105032417 12:132893062-132893084 CTGTGCTGCCGCAAGGTTTCGGG + Intronic
1105414004 13:20193307-20193329 CTGTGCCGTGGGCGGGGTTCAGG + Intergenic
1106971368 13:35145590-35145612 CTGTACTGCCTCCGGGCTTTAGG - Intronic
1109531151 13:63649956-63649978 CTGTCCAGCCTTCGGGGTTCAGG - Intergenic
1109567017 13:64131192-64131214 CTGAGCTGCTGCCTGGGTTTGGG - Intergenic
1113324514 13:109268694-109268716 CTGTGCTGCCGCAAGGTTCCAGG + Intergenic
1114770687 14:25426765-25426787 CTGTGCTGCCTCAAGGCTTCAGG - Intergenic
1115755013 14:36520745-36520767 CGCTCCAGCCGCCGGGGTTCAGG - Intronic
1119468943 14:74881791-74881813 CTGCGCTGCAGCCGGGATACTGG + Intergenic
1120659769 14:87237397-87237419 CTGTGCTGCCGCAAGGTTTCAGG - Intergenic
1120823016 14:88930421-88930443 GTGTGCTGCGGCTGGGGGTCAGG - Intergenic
1120922872 14:89771123-89771145 CTGTGCTGTTGGCTGGGTTCAGG - Intergenic
1121193099 14:92047071-92047093 CTGTACTGCCGCAAGGCTTCAGG - Exonic
1123108357 14:105853375-105853397 CTGTGCTGGCACCGGGGCTTTGG - Intergenic
1126673369 15:51136571-51136593 CTGTGCTGAAGCTGGGGTTGGGG + Intergenic
1126843937 15:52741933-52741955 CTGTGCTGCCGCAAGGTTTCAGG + Intergenic
1130355439 15:83125795-83125817 CTGTGCAGCAGGCTGGGTTCAGG + Intronic
1132105436 15:99059408-99059430 CGGAGCTGCCGACGGGGTCCGGG - Intergenic
1132153187 15:99476573-99476595 CTGTGCAGGCTCCGGGGCTCCGG + Intergenic
1132253203 15:100350013-100350035 GTGTGCTTCCTCCTGGGTTCTGG + Intergenic
1132868734 16:2106162-2106184 CCGTGCTGCCCCCGGGTTTCAGG - Exonic
1133766566 16:8842449-8842471 CTGTGCTGCCACAAGGTTTCAGG - Intronic
1134522851 16:14926497-14926519 CCGTGCTGCCCCCGGGTTTCAGG + Intronic
1134549776 16:15133561-15133583 CCGTGCTGCCCCCGGGTTTCAGG - Intronic
1134710519 16:16325148-16325170 CCGTGCTGCCCCCGGGTTTCAGG + Intergenic
1134718689 16:16369436-16369458 CCGTGCTGCCCCCGGGTTTCAGG + Intergenic
1134949083 16:18343497-18343519 CCGTGCTGCCCCCGGGTTTCAGG - Intergenic
1134956066 16:18382723-18382745 CCGTGCTGCCCCCGGGTTTCAGG - Intergenic
1135762022 16:25145395-25145417 CTGTGCTTCCCCAGGGCTTCTGG - Intronic
1136995897 16:35187914-35187936 CTGGGCTTCCCCCTGGGTTCTGG + Intergenic
1139433812 16:66925152-66925174 CTCCGCTGCCGCCGCCGTTCAGG + Exonic
1139485331 16:67252978-67253000 CAGTGCTCCCGCTGGGGTTCAGG + Intronic
1141165964 16:81661313-81661335 CCGTGCTGCCTCCCGTGTTCAGG - Intronic
1141962692 16:87420178-87420200 ATGTGCTGCTGCCGGGGCCCTGG - Intronic
1142007693 16:87697481-87697503 CTGGGCTCGCGCCGGGGCTCTGG + Exonic
1143036620 17:4003334-4003356 CTGTGCTGCAGCCGTGGCTGGGG + Intergenic
1143452381 17:7043560-7043582 CTGTGCTTCCGCTGGGGAGCTGG + Exonic
1147217361 17:38908569-38908591 CTGTGCTGCCACGTGGGTGCCGG + Intronic
1147218163 17:38912832-38912854 CTGAGCTGGCGCCGAGGCTCTGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151264781 17:72946414-72946436 CTATGCTGCAGCCAGGGCTCTGG - Intronic
1152040688 17:77900765-77900787 CTGTGCTGGCCCCAGGGTTCAGG + Intergenic
1152256234 17:79241481-79241503 CTGTCCTGGTGCCAGGGTTCAGG + Intronic
1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG + Intronic
1152460451 17:80439494-80439516 CTGGGCTGCTGCCGGGGTTGGGG - Intergenic
1152525210 17:80884552-80884574 CTGTGCTGGCCCTGGGGTCCGGG - Intronic
1152732222 17:81977905-81977927 CTGCGCTTCCGCTGGGGTCCCGG + Intronic
1154070617 18:11148990-11149012 CTGTGCTCCCGCCTGGCTCCCGG + Intergenic
1154314769 18:13296007-13296029 CTGGGCTGCCGGTGGGGTCCTGG - Intronic
1157814614 18:50721801-50721823 CTGGGCTGGGACCGGGGTTCTGG - Intronic
1160542299 18:79630774-79630796 CTGTGGTGCCGTCGGGAGTCAGG - Intergenic
1160906384 19:1453504-1453526 CTGGGCTGCCCTCGGGGGTCCGG - Exonic
1161354533 19:3811415-3811437 CTCTGCTGCCGACGGGGTGAGGG + Intronic
1161398540 19:4057840-4057862 GGGTGCTGCCGGTGGGGTTCGGG - Intronic
1161689164 19:5720833-5720855 CTGGGGTGCTGCCGGGGGTCGGG + Intronic
1163243305 19:16077037-16077059 CGGGGCTGGCGCCGGGGTCCCGG + Intronic
1163719807 19:18893767-18893789 CTGTCCGGCCGCCGCGGTGCTGG + Intronic
1163900023 19:20092977-20092999 CTGTGCTGCCGCAGGGTTTCAGG - Intronic
1166076108 19:40414699-40414721 CTGTGCCGCCCCCCGGGGTCTGG - Intergenic
1167901295 19:52624083-52624105 CTGTACTGCCGCAAGGCTTCCGG + Intronic
1168240359 19:55086148-55086170 CTGTGGTGCAGCCGGGGTCCGGG - Exonic
926120355 2:10238285-10238307 CTGTGCTGCCTGCGAGGCTCAGG - Intergenic
929456372 2:42068981-42069003 ATGTGCTGCTGCCTGGGCTCTGG - Intergenic
931256927 2:60581938-60581960 CTGTGCCGCCGCCGTGGGCCGGG + Intergenic
932367056 2:71160295-71160317 CTGTACTGCCGCAAGGTTTCAGG - Intergenic
933271993 2:80242870-80242892 CTATGCTGCCACCAGGGTCCAGG + Intronic
933912033 2:86949845-86949867 CACTGCTGCCTCCCGGGTTCAGG + Intronic
934010961 2:87820052-87820074 CACTGCTGCCTCCCGGGTTCAGG - Intronic
935591871 2:104852485-104852507 CTGGGCTGCCGCTCGGGCTCGGG + Intergenic
941456009 2:165712858-165712880 CTGTGCTGCCGCAAGGTTTCAGG - Intergenic
943625249 2:190191222-190191244 CTGTTCTGCCTCCTGGATTCAGG + Intronic
945173642 2:207020600-207020622 CTGTGCTGCTGCAAGGTTTCAGG + Intergenic
945301301 2:208218593-208218615 CTGTGCTGCCACAAGGTTTCAGG - Intergenic
948658563 2:239492196-239492218 CTGTGCTCCCTCCGGAGCTCAGG + Intergenic
948673663 2:239584557-239584579 CTGTGCTGCCGACTTGGTGCGGG + Exonic
1172932279 20:38595069-38595091 CTGTGCTGCCGCAAGGTTTCAGG - Intergenic
1173334267 20:42100261-42100283 CCGTGCTCCTGCCGGGTTTCAGG + Intronic
1173652232 20:44673712-44673734 CTGTACTGCCGCAAGGCTTCAGG + Intergenic
1175863117 20:62160639-62160661 CTGTCCTGCTGACGGGGTTCCGG + Intronic
1176260430 20:64176690-64176712 CCTTGGTGCCGCCTGGGTTCCGG + Intronic
1179470894 21:41609690-41609712 CAGTGCTGTTGCCTGGGTTCAGG + Intergenic
1179823807 21:43952618-43952640 ATGTGCTGGCGCCAGGCTTCCGG + Intronic
1179943110 21:44652385-44652407 CTGTGCTGGTACCGGGGTGCTGG - Intronic
1180987999 22:19916932-19916954 CCGTGCTGCAGCAAGGGTTCTGG + Intronic
1181917325 22:26291759-26291781 CTGTCCTGCAGACGGGGTTAGGG + Intronic
1181966937 22:26663365-26663387 CTGTGATGCCGACGGGGTCATGG - Intergenic
1185251502 22:49804098-49804120 CGGTGCTGCCCCCTGGGCTCAGG - Intronic
1185269344 22:49921775-49921797 CTGGGCTGGCCCCGGGGTTGAGG + Intronic
1185285539 22:49998186-49998208 CTGTGCTGGCGCCCGGGGCCGGG - Exonic
951204208 3:19909205-19909227 CTCTGCTGCTGCCGGGGTTGGGG - Intronic
952895033 3:38073025-38073047 CTGTGCTGCCGCAAGGTTTCAGG - Intronic
953656369 3:44858039-44858061 CTGTACTGCCGCAAGGCTTCAGG - Intronic
956815939 3:72908396-72908418 CTGTGCTGCCACCCGAGCTCTGG + Exonic
960096729 3:113696607-113696629 CCGCGCTGCCGCCGGGTCTCCGG - Exonic
962205761 3:133432470-133432492 CTGTGCTGCCACAAGGTTTCAGG + Intronic
963319922 3:143800638-143800660 CTGTGCTGCCGCAAGGCTTCAGG + Intronic
965335286 3:167425945-167425967 CTGTGCTGCCGCAAGGCTTCAGG + Intergenic
965624700 3:170674880-170674902 CTGTGCTGCCACAAGGTTTCAGG - Intronic
965639848 3:170820320-170820342 CTGTGCTGCCGCAAGGTTTCAGG - Intronic
966881432 3:184353332-184353354 ATGTGCTGCCGCCGGCGGGCTGG + Exonic
968547598 4:1206746-1206768 CTCTGCTGCTGGCGGGGTCCCGG - Intronic
968557376 4:1253123-1253145 CTGTCCTGCTGCGGCGGTTCTGG - Intergenic
969653895 4:8485135-8485157 CTGTGCTGCCTCAAGGTTTCAGG - Intronic
969696696 4:8738902-8738924 CGGTGCTGCAGCCGGTGGTCAGG - Intergenic
971452944 4:26817282-26817304 CTAAGCTGCCGGCGGGGTGCGGG - Intergenic
979327590 4:119397670-119397692 GAGTGCTGCCTCCCGGGTTCAGG + Intergenic
982083791 4:151814970-151814992 CTGTGCTGCCGCAAGGTTTCAGG - Intergenic
982202903 4:152976075-152976097 CTGTGCTGCTGGGGGGATTCTGG - Exonic
982460970 4:155667857-155667879 CCCTGCTGCCTCCGGGGTCCAGG - Intronic
983533369 4:168832916-168832938 CAGTGCTGCAGCTGAGGTTCGGG - Intronic
984708114 4:182862657-182862679 CACTGCTGCTGCCGGGGCTCTGG + Intergenic
985122774 4:186660608-186660630 CTGTGCTCCCGCCGGGGCTGGGG + Intronic
985630937 5:1013666-1013688 CTGTCCTGCAGCAGGGGCTCTGG + Intronic
987622555 5:20354449-20354471 CTGTACTGCAGCCGGGGTGTTGG - Intronic
991900558 5:71455808-71455830 CCGGGCAGCCGCCGGGGCTCGGG + Exonic
992957152 5:81921893-81921915 CTGAGCTGCGGCTGGGGTCCGGG + Intergenic
995203314 5:109450578-109450600 CTATTCTGCCACCGGGGTTCTGG - Intergenic
1000330218 5:160199808-160199830 CTGGGCTGGTGCGGGGGTTCAGG - Intronic
1001354118 5:171003750-171003772 CTGTACTGCCGCAAGGCTTCAGG - Intronic
1002000419 5:176193754-176193776 CTGTGCTGAGGATGGGGTTCAGG - Intergenic
1002253917 5:177945227-177945249 CTGTGCTGAGGGCGGGGTTCAGG + Intergenic
1002712007 5:181200961-181200983 CTGGGCTGCCGTCAGGGTTGAGG - Intronic
1003099927 6:3169216-3169238 CTGTGCTGCCGCAAGGTTTCAGG + Intergenic
1003270496 6:4603491-4603513 TTGTGCTGCGGCCGGAGTTTTGG - Intergenic
1003394855 6:5744257-5744279 TTGTCCTGCCGCAGTGGTTCTGG - Intronic
1004116257 6:12770869-12770891 CTGTGCTTCAGCAGGGCTTCAGG + Intronic
1007309232 6:40932387-40932409 CTGAGCTGCTGCCTTGGTTCAGG - Intergenic
1007531611 6:42547807-42547829 CTGAGCTGCCGCCGGTTTTGTGG + Intergenic
1009464516 6:63953230-63953252 CTGTACTGCCGCAAGGCTTCAGG + Intronic
1011195132 6:84773397-84773419 CTGGGCTGGAGCCGGGATTCCGG - Intergenic
1013709544 6:112880455-112880477 CTCTGCTGCAGCCGGGGTAATGG + Intergenic
1014115166 6:117662078-117662100 CTGTGCTGCCGCAAGGCTTCAGG - Intergenic
1020270472 7:6591846-6591868 GTGTGCTGCCTCCTGGCTTCAGG + Exonic
1020280851 7:6649302-6649324 CTCTGCTGTCCCCTGGGTTCTGG + Intronic
1021637504 7:22706592-22706614 CTGTGTTGCCGCAAGGTTTCAGG + Intergenic
1027158502 7:75785276-75785298 CTGTGCTACCGCAAGGCTTCAGG + Intronic
1028589711 7:92482145-92482167 CTGTACTGCCGCAAGGCTTCAGG - Intergenic
1030348054 7:108455661-108455683 CTGTGCTGACCACGGAGTTCGGG - Intronic
1033208111 7:139439704-139439726 CTGTGCTGAGGCAGGGGTCCAGG - Intergenic
1033219180 7:139516748-139516770 CTTTGCTGGTGCTGGGGTTCTGG - Intergenic
1033451180 7:141463574-141463596 CTGAGCTGCCGCCATGGATCAGG + Intronic
1033474184 7:141674866-141674888 CGGTGCTGCCTTCTGGGTTCTGG - Intronic
1034255166 7:149720788-149720810 CTGAGCAGCCGCAGGGGTGCGGG + Intronic
1034840488 7:154391083-154391105 CTGGGCTGCAGCGGGCGTTCTGG + Intronic
1035066182 7:156106472-156106494 CTGTGCTGCCTCCGAGCCTCAGG - Intergenic
1036639668 8:10574617-10574639 CTGTACTGCCGCAAGGTTTCAGG + Intergenic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1045013636 8:97980340-97980362 CTGTGCTGTCGTCGTGGTTGGGG + Intronic
1046167242 8:110452419-110452441 CAGTGCTGCCGCCAGGGATTGGG + Intergenic
1049868640 8:144956622-144956644 CTGTGCTGCTGCAAGGTTTCAGG - Intergenic
1059332248 9:113542933-113542955 CTGTGCTGCCGCAGGGCTGAAGG + Intronic
1059485596 9:114624265-114624287 GTGTGATGCCGCCAGGCTTCGGG + Intronic
1061601230 9:131671507-131671529 CTTTGCTGCCACAGAGGTTCTGG + Intronic
1062692136 9:137847467-137847489 CTGTGCTGCCGCAAGGTTTCGGG + Intronic
1062731887 9:138114522-138114544 CTGTGATGCCTCCGAGGCTCTGG + Intronic
1191641282 X:63431504-63431526 CTGTACTCCCACAGGGGTTCCGG - Intergenic
1200125514 X:153812325-153812347 CTGTCCTGCCCCGGGAGTTCAGG - Intronic
1200160326 X:154004431-154004453 CTGTGTTTCCGCCGGGCCTCGGG - Intergenic