ID: 1077887650

View in Genome Browser
Species Human (GRCh38)
Location 11:6397609-6397631
Sequence GCACCTAGTTGGAGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077887650_1077887655 9 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887655 11:6397641-6397663 AGCCATGCCTGCTGCAGGGCAGG 0: 1
1: 0
2: 1
3: 52
4: 390
1077887650_1077887654 5 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887654 11:6397637-6397659 AGGAAGCCATGCCTGCTGCAGGG 0: 1
1: 0
2: 5
3: 35
4: 309
1077887650_1077887658 15 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887658 11:6397647-6397669 GCCTGCTGCAGGGCAGGGAGAGG 0: 1
1: 1
2: 8
3: 134
4: 939
1077887650_1077887656 10 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887656 11:6397642-6397664 GCCATGCCTGCTGCAGGGCAGGG 0: 1
1: 0
2: 4
3: 46
4: 423
1077887650_1077887653 4 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887653 11:6397636-6397658 TAGGAAGCCATGCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077887650 Original CRISPR GCACCTAGTTGGAGCCCTGA AGG (reversed) Intronic