ID: 1077887654

View in Genome Browser
Species Human (GRCh38)
Location 11:6397637-6397659
Sequence AGGAAGCCATGCCTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077887652_1077887654 -6 Left 1077887652 11:6397620-6397642 CCAACTAGGTGCTGTCTAGGAAG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1077887654 11:6397637-6397659 AGGAAGCCATGCCTGCTGCAGGG 0: 1
1: 0
2: 5
3: 35
4: 309
1077887650_1077887654 5 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887654 11:6397637-6397659 AGGAAGCCATGCCTGCTGCAGGG 0: 1
1: 0
2: 5
3: 35
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077887654 Original CRISPR AGGAAGCCATGCCTGCTGCA GGG Intronic